AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    --------->YAB1                                             --------->YAB5    --------->At4g35610
    <---------ICU4                                             --------->ATHB12 --------->GATA12
   --------->ICU4               --------->ARR11(3)             --------->YAB1   <---------GATA12
  --------->AHL20(3)           --------->YAB5                 --------->ICU4 <---------ALFIN1
  <---------AHL20(3)           <--------ATHB1             --------->ZAT18 --------->ANAC58
  <---------AHL25(2)           --------->YAB1            <---------ANAC46 ----------->HVH21
  --------->AHL25(2)          --------->ICU4        <---------ANAC55(2) <---------O2
 --------->AHL12(2)           <---------ATHB12      <---------O2        --------->ANAC58
 --------->YAB1               <---------YAB5        --------->ANAC55(2) --------->ANAC46
----->YAB1          ---------->DOF2                 <---------REM1(1)   <---------TGA1a
------->GT1        <---------AHL20(2)               --------->O2        --------->ANAC58   ---------
tgtaaaataatgaaattcaaatttaaagcttcaatgattttgttaagacagagagacgtagcgcattgattacagacgcgacacatctgacatacaacat  221900
    <---------ZAT14                             <---------MYB52(1)           <---------ANAC58      <
    --------->ZAT14                            --------->TOE2(3)     --------->AHL12(2)          ---
--------->ZAT6       <---------LBD16     <-----------GT1          <---------GLK1(2)          <------
===RAV      --------->ANAC58         <---------TOE2(3)  --------->WOX13(1)   <---------ANAC58<------
-->RAV1(1)  --------->ANAC46     --------->TOE2(3)   --------->RVE1(2)<---------YAB1 <---------MYB52(1)
ttgccactacaatgcacgactgtcttcggattaatacattaatgttacatcgttagtatcaatcttacagattataaatagcttagccgattgtttaaga  222000
                                                           --------->AHL12(2)                      <
                                                           <---------AHL12(2)                      <
                                                          --------->YAB1                           -
                                                         <---------AHL12(1)                        <
                                                         --------->AHL12(1)                        -
                                                       --------->AHL12(2)                          <
                                                      <---------AHL20(2)                           <
                                                     --------->AHL25(3)                 <---------DOF5.7(1)
                                               ----------->GT1                         =============
                                              <---------TOE2(3)                        <------------
    <---------YAB1                           ---------->DOF2                           <---------DAG2
  --------->KAN1            <---------------AtSPL8   --------->AHL20(2)                <----------DOF2
 <---------YAB1    --------->KAN1       ------->GAMYB<---------AHL20(2)                -------------
---------ZAT6   --------->ARR14(2)     <---------ALFIN1<---------AHL12(2)             <-------------
-------->GT1    --------->ARR11(2)   ----------->RAV1(1) <---------AHL20(2) ----------->GT1       --
---TOE2(3)      <---------ARR11(2)  --------->MYB46(3)<---------AHL25(3) <---------REM1(1)      ----
---YAB1     <-------TEIL    <---------------AtSPL3  --------->AHL12(2)  <---------TOE2(3)       ----
tagtattattctaaattcatatacactcgtgcaagtacaacaacacactaaagttattaaataataaacacatttgatgtagataaactactttttttag  222100
                       --------->KAN1                                                              >
      <---------ZAT14 --------->ARR11(3)                                                          <-
     <----------DOF2  --------->AHL25(3)                                                        <---
 ----------->HVH21    <---------AHL25(1)                                                       -----
-------->O2           <---------AHL25(3)                                                     <------
---------TGA2(1)      <---------AHL12(1)                                                     <------
-------->TGA2(1)      <---------ARR11(3)                                                     =======
---------TGA1a        --------->AHL12(1)                                                     =======
---------O2           --------->AHL25(2)                                                     -------
---------ANAC58       <---------AHL25(2)                                                     -------
-------->bZIP60(1)    <---------AHL20(3)                                                     <------
================bZIP_DOF                                                                     <------
================bZIP_DOF       ---------->DOF2                                               <------
---------ANAC58       --------->AHL25(1)                                                     =======
---------bZIP60(1)    --------->AHL20(3)                                                     -------
---------bZIP60(2)    <---------AHL20(2)                                                     <------
-------->TGA1a        --------->AHL20(1)                                                     <------
---------ANAC55(2)    <---------AHL20(1)                                                     <------
-------->ANAC55(2)    --------->AHL20(2)                                                  ----------
---------ANAC55(1)  <---------AHL12(2)                                       =======================
---------ANAC46     --------->AHL12(2)                             --------->DAG2       <---------At4g35610
=========bZIP_DOF  --------->YAB1                    ---------->DOF2         =======================
---AGL15           <---------AHL20(3)                ===============================================
-->AGL15           --------->AHL25(1)         <---------ICU4      ---------->DOF2       --------->At4g35610
----AGL3           --------->AHL20(3)        --------->ICU4       ==================================
--------->STF1     --------->AHL20(2)        --------->KAN1       ==================================
------->HVH21     <---------ATHB12      --------->YAB1 --------->ANAC58      =======================
------->TGA1      <---------ATHB51      ----------->GT1--------->ANAC58      ------->GAMYB----------
tgacgtgactttacaggcccaataatatattctgaaaagcccatagtaatattcacaaaagccccttgataaagttgcaacgcgcgtacttatctgacgt  222200
--------->O2                                                   ------>ZmHOX2a(2)
-------->MYB59                                                 ===================HOX2a_HOX2a
>>>>>>GRF7<---------TGA1a                                      ==================================HOX2a_HOX2a
----------RAV1(2)                                             ===================================HOX2a_HOX2a
--------HVH21                                                 <---------At4g35610
------>HVH21                                                  <---------KAN1
---ANAC46 <<<<<<<<<<HY5                                       ====================HOX2a_HOX2a
---ANAC55(2)                                                  --------->At4g35610
===================================bZIP_DOF                   <------ZmHOX2a(2)
===============bZIP_bZIP                                     --------->GATA12
-->ANAC55(2)                                                 --------->RVE1(2)
-->TGA1a  --------->O2                                       <---------GATA12
---TGA1a  <---------O2                                       ------->TEIL
---bZIP60(2)                                                 --------->ARR14(2)
---O2--------->ANAC58                                        <---------ARR14(2)
===================================bZIP_DOF                  <---------RVE1(2)
-->O2--------->O2                                            --------->ARR11(2)
---ANAC58 ===============================================bZIP_DOF
---ANAC55(1)      ----------->GT1                            <---------ARR11(2)
---ANAC58 ==================================bZIP_DOF         <---------AGP1             <---------TOE2(3)
->HVH21  ------>NtERF2             <----------ID1            --------->GLK1(2)    <---------DAG2
===============MYC_MYB           ---------->DOF2        --------->MYB52(1) --------->LBD16
===MYC_MYB=========================bZIP_DOF          --------->ANAC58      ------>ZmHOX2a(1)
===bZIP_DOF------->PIF5  --------->DAG2              --------->ANAC46  <---------ARR14(2)
===bZIP_DOF------->MYC4  --------->DOF5.7(1)         --------->ANAC58  --------->ARR11(2)   --------
===bZIP_DOF<-------MYC4 --------->DOF5.7(1)   <---------DOF5.7(1)      <---------ARR11(2)   <-------
====================MYC_MYB  ----------->GT1  <----------DOF2<-----------ARR10    <----------DOF2  <
->TGA1  <---------ALFIN1---------->DOF2      <---------DOF5.7(1)       --------->ARR14(2) <------ZmHOX2a(1)
gtcaggtcacgccacgtggattagaaaaaaagtggtaaaagacaaaacccttttgtactcaacggatctgagtgaatcctgaaaacttttttaggatttc  222300
                   --------->YAB5                        <---------YAB1
                   *TSS                               <----------DOF2
                   <--------ATHB1                    <---------ANAC58
                  <---------YAB5                 <-------MYC2
              <---------MYB55(2)                 ------->MYC3
              ------------>CBF                   ------->PIF5
              --------->MYB46(3)                 <-------MYC3
              <---------ATHB12                   ------->MYC2
             ------>MYB83                       <---------O2
             --------->ANAC58                   =================bZIP_DOF
             ------>MYB46(1)--------->ARR14(2)  --------->O2
             -------->P     <---------GATA12 <---------REM1(2)
             --------->ANAC58<------ZmHOX2a(2)  --------->ANAC46             <---------GATA12
             =============================================MYC_MYB            --------->GLK1(2)
           --------->AtMYB61<---------ARR14(2)  --------->TGA1a              --------->RVE1(2)
           <---------MYB111(1)------>ZmHOX2a(2) <---------bZIP60(2)         --------->GLK1(1)
        <-----------GT1     --------->GATA12<-----------HVH21           --------->ANAC58
   <---------RVE1(2)<---------GLK1(2) <---------KAN1 <---------ANAC46   --------->ANAC46
  --------->ATHB12<---------ATHB12 --------->YAB5<-------PIF5    --------->KAN1         <---------WOX13(2)
->GLK1(1) --------->MYB46(3)<---------ARR11(2)  <---------TGA1a<-----------GT1      --------->YAB1<-
--GLK1(1) --------->DEAR3(2)--------->ARR11(2)  --------->ANAC55(2)     --------->ANAC58--------->WOX13(2)
------------CBF   --------->ICU4  <---------ATHB12   <---------ANAC58  --------->LBD16 <-----------GT1
aaaattgatttgaaccaaccaatgattcttggatcccatgaataagccttcacgtggcttttgatttcacattccacgaaaatccaattttaactgaatt  222400
                                                                           <---------O2            -
               <---------ZAT6                                            ------>NtERF2             <
   <---------AHL20(3)                                               <---------ZAT2<---------ARR11(2)
   --------->AHL12(2)                   ----------->GT1             --------->ZAT2--------->ARR14(2)
   --------->AHL20(3)              --------->YAB1                   <---------At4g35610            <
   <---------AHL12(2)      <------MYB83 <---------ZAT6              --------->At4g35610           --
  <---------AHL12(1)       <------MYB46(1)                          <---------GLK1(1)        <------
  --------->AHL12(1)      --------->MYB59              <---------ANAC58 ----------->HVH21    -------
<---------RVE1(2)         <---------TOE2(3)--------->KAN1           --------->GLK1(1)        <------
--------TOE2(3)<---------YAB5     <---------YAB5       <---------ANAC58 --------->DEAR3(1)   -------
tgagataattttggtttagtgatggcgattaggttgaatcatagtgtaattccagtgagcgtgaagcttggagctccgacgagagtatcggctcggagct  222500
    <---------MYB52(1)  --------->ALFIN1
<---------DOF5.7(2)     <------NtERF2
<---------At5g28300   <---------ANAC46
-------->ARR11(2)     <---------ANAC58                                                         <----
---------ARR11(2)     <---------ANAC58                                                     <--------
-----------GT1   <---------ARR14(2)                                               <---------ZAT14<--
------->DOF5.7(2)--------->ARR14(2)                                               --------->At4g35610
---ZAT2          --------->GATA12                      <---------MYB52(1)         <---------At4g35610
-->GLK1(1)       <---------RVE1(2)                    <----------DOF2----------->GT1     --------->ZAT14
---At4g35610     <---------GATA12          --------->LBD16      <---------HSFB2a(2)      --------->ZAT18
-->ZAT2        <---------RVE1(2)         <---------LBD16        --------->HSFB2a(2)      <---------ZAT14
cgttaccgttcagcgttggagattggcgtggtgtttctacattttccggtgctaggcctttggttctcgcgaaggtgaaactgagagcagagagtactga  222600
 --------->ARR14(2)        --------->YAB5
 <---------GATA12       ------>NtERF2
 --------->GATA12 --------->YAB5                  --------->ALFIN1
 <---------ARR14(2)    --------->DEAR3(1)--------->ZAT2                          --------->MYB52(2)<
-----TOE2(3)<---------WOX13(2)           <---------At4g35610             <-----------GT1   ---------
-ZAT14      --------->WOX13(2)           <---------ZAT2  <---------KAN1  --------->KAN1    ---------
----ZmHOX2a(1)   ----------->TGA1        --------->At4g35610         --------->YAB5----------->HVH21
ggaagatcgagttccaattgatgacgacgacgattctactgatcagctcgtaagtgtggaatttcatttggatgattcactcgtttgtgaccagaatcaa  222700
                   <-------TEIL                           --------->ATERF1(2)
                <------MYB46(1)                           <---------ATERF1(2)
                <------MYB83                             <---------ANAC58
               --------->MYB59                           <---------ANAC58
               --------->MYB46(2)                       <---------At4g35610
             <---------MYB52(1)                <---------ANAC58   <---------ANAC58         -------->P
-----------GT1 --------->MYB111(1)             <---------ANAC58   <---------ANAC46     <---------YAB1
>GLK1(2)     <<<<<<<<<MYB98       <---------ZAT18  <---------RVE1(2)        ------>ZmHOX2a(1)
>RVE1(2)<---------MYB52(1) --------->ARR11(3)  ----------->GT1 ---------->CDC5 <---------ARR11(2)
ttttactcttcgttttgttaggttgatgaagaaattgtgcatttcgaagagcgtgattttgctggcacagcgtgtgttcctgtatatgttatgctaccag  222800
<- Previous    Next ->

AGI:  At4g00490.1   
Description:  BAM2/BMY9 (BETA-AMYLASE 2); beta-amylase. similar to BAM7/BMY4 (BETA-AMYLASE 7), beta-amylase [Arabidopsis thaliana] (TAIR:AT2G45880.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39608.1); similar to hypothetical protein OsJ_029213 [Oryza sativa (japonica cultivar-group)] (GB:EAZ45730.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39607.1); contains InterPro domain Glycoside hydrolase, family 14B, plant; (InterPro:IPR001371); contains InterPro domain Glycoside hydrolase, family 14; (InterPro:IPR001554); contains InterPro domain Glycoside hydrolase, catalytic core; (InterPro:IPR013781)
Range:  from: 222320    to: 225131    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version