AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                        <---------DOF5.7(1)
                                                                       <---------DOF5.7(1)
                                                                       <----------DOF2
                                                                       <---------DAG2
                                                                      <----------DOF2
                                                                      <---------DAG2
                                                                      --------------------->WRI1
                                               --------->ANAC58  --------->ARR14(1)
                                               --------->ANAC46 <---------ARR11(2)
                                               --------->ANAC58 --------->ARR14(2)
                                  ====================================HOX2a_HOX2a
                                 =====================================HOX2a_HOX2a
            <---------ATHB12     <------ZmHOX2a(2)              --------->ARR11(2)
        <---------ATHB12        <---------GATA12                --------->GATA12
     <XXXXXXXXXXXXXXXXXXXXMIR864-5P         --------->ZAT14     <---------GATA12
 <----------DOF2                --------->GATA12                <---------ARR14(2)                <-
---------At4g35610              --------->ARR11(3)              <---------GLK1(2)       <----------DOF2
-------->At4g35610<---------ANAC46------>ZmHOX2a(2)             --------->ARR11(1)     <---------DOF5.7(1)
---------ZAT2--------->YAB5     <---------ARR11(3)             <------ZmHOX2a(1)      ------>ZmHOX2a(1)
-------->ZAT2<---------ICU4    --------->GLK1(1)             <---------TOE2(3)  <---------YAB5<-----
-----HVH21--------->WOX13(1)   <---------GLK1(1)    --------->KAN1    <---------DOF5.7(1)  ---------
 
tcagctttgaaatcaatcactgcctgtagaagagagatctcatcttcttcactccatactctctgaggattcgcctttttgttatcgtcctctttcttaa  113600
                                                                   <---------MYB46(3)
                                                                 <---------MYB52(1)
                                                                --------->LBD16
                                                               --------->DEAR3(1)
                                                               <---------DEAR3(1)
                                                               --------->ATERF1(2)
                                     --------->At4g35610     ------>NtERF2               <<<<<<<<<TBF1
                                     <---------ZAT2          --------->ABI4(1)      <----------DOF2
           <---------KAN1            <---------At4g35610    --------->DEAR3(1)     <---------DOF5.7(1)
          ------->TEIL          --------->REM1(1)          --------->MYB46(3)   <---------DOF5.7(1)
       --------->AtLEC2  <---------ANAC58                 <---------At5g28300<---------ALFIN1
    <---------RVE1(2)   <-------TEIL --------->ZAT2     <---------ZAT14     --------->At4g35610
--------DOF5.7(1)      --------->ALFIN1<---------ZAT18<---------bZIP60(1)--------->At4g35610
------GT1<---------AtLEC2<---------ANAC58             --------->bZIP60(1)<---------At4g35610    ----
>TOE2(3)<-------TEIL <---------At4g35610         --------------------->WRI1 <---------At4g35610-----
 
ctcttttgacatgcatgtcccttgaggtgcttccttcaccagctcgcttcttccctgacttcaccgccggtgattcagcagcaccttctttcttcttccg  113700
                                                                      <---------GATA12
                                                                      <---------ARR11(3)
                                                                      --------->ARR11(3)
                                                                      <---------RVE1(2)
                                                                   <------ZmHOX2a(1)
                                                               <------NtERF2
                                                             <---------ANAC46
                                       <---------KAN1       <---------LBD16
                                      --------->GLK1(2)     <------NtERF2
                                      --------->ARR14(2)    --------->At4g35610
                                      <---------ARR14(2)   <---------RAP2.3(1)
            --------->ATHB12         <---------GLK1(2)    <---------RAP2.3(2)          =============
            --------->YAB5    --------->At4g35610         <---------DEAR3(1)           <------ZmHOX2a(1)
    --------->DOF5.7(1)       <---------At4g35610        <---------At4g35610           =============
------->RAV1(2)   <----------DOF2--------->At4g35610     --------->At4g35610<---------TOE2(3)    ---
->NtERF2   <---------KAN1  <---------YAB5             <---------At5g28300   <---------TOE1(3)   <---
 
cctggttaagacgaatgactgcttctctgagtcatcagaagaatctgtcttagaattcacagcggcggaaggagattttagggttttagaggaaggaact  113800
                  <----------DOF2
       <----------DOF2
      ------>ZmHOX2a(2)
     <------ZmHOX2a(2)
    --------->GATA12
    <---------ARR11(2)
    <---------ARR14(3)
    --------->ARR14(3)                                <---------ARR11(3)
    <-----------ARR10                      ------>ZmHOX2a(2)
    <---------GATA12                      <------ZmHOX2a(2)
    --------->GLK1(2)                     <---------GLK1(1)
    --------->ARR11(3)                    --------->GLK1(1)
    --------->ARR11(2)                   <---------ARR11(3)
    <---------ARR14(2)                   --------->ARR11(3)                               <---------
    --------->ARR14(2)                   <---------AGP1                             <---------ANAC58
    <---------ARR11(3)                   --------->GATA12                          --------->At4g35610
   <---------GLK1(2)                     <---------GATA12                         <---------MYB46(3)
   <------ZmHOX2a(1)                     --------->RVE1(2)                        --------->MYB55(2)
============HOX2a_HOX2a   --------->At4g35610     --------->At4g35610            <--------P       --
=============HOX2a_HOX2a  <---------At4g35610     <---------At4g35610           <-------GAMYB  -----
-------->HVH21   <---------ANAC58       --------->RVE1(1)            <----------DOF2<---------ANAC58
--------HVH21    <---------ANAC58    ---------->DOF2  --------->ARR11(3)       <---------MYB46(3)---
 
gtgacaggatctttgggtttgctttcttcagaagaagacttaaagatctcttcagaagaactctcaacttcgcttgaagaagcggttgctggactttcca  113900
                                    --------->YAB5
                                   <---------YAB1                                                ---
                        --------->ARR11(2)                                                       <--
                        <---------ARR14(2)                                                       ---
                        <---------GLK1(2)                                                      -----
         <---------RVE1(2)   <---------ANAC46                                      <---------ANAC58
         --------->GATA12--------->GLK1(2)                                         <---------ANAC46
   --------->ATHB12     <---------RVE1(2)                                          <---------ANAC58
 >>>>>>>>>>>>>>>>>LFY   --------->ARR14(2)                                     <---------At4g35610
 <<<<<<<<<<<<<<<<<LFY   <---------GATA12                             <---------TOE1(3)       <------
-DOF2    <---------GLK1(2)   <---------LBD16         ----------->HVH21         <-------GAMYB--------
------->DOF5.7(1)       --------->GATA12           <---------At4g35610         --------->At4g35610
----->DOF2  <-----------GT1 <---------LBD16   --------->ALFIN1   *TSS<---------TOE2(3)   <----------DOF2
------>DOF5.7(1)  <----------DOF2<---------KAN1    --------->At4g35610        --------->MYB52(2) <--
 
aaggagccattggattttcttctttcagattctcgggtatgagtaccaagtgggaactgaagggacaattttagggtttgtgagttgcgagactttttat  114000
                                                                                                   -
                                                                                                  --
                                                                                                <---
                                                                                        <-----------GT1
                                                                                   --------->AHL20(2)
                                                                                   <---------AHL25(3)
                                             ---------->DOF2                      <---------AHL20(2)
       --------->At5g28300                 <---------WOX13(2)                     --------->AHL12(1)
      ----------->GT1                   --------->AHL20(2)                        --------->AHL12(3)
   --------->ZAT6                     ----------->GT1                             <---------AHL12(3)
 <-----------GT1                     <---------TOE2(3)                            --------->AHL25(3)
------>AHL20(2)                     ---------->DOF2                               <---------AHL25(1)
-------AHL20(3)                    --------->AHL20(2)                             <---------AHL12(1)
------>AHL20(3)                    --------->YAB1                                 --------->AHL20(2)
---->AHL12(2)                    --------->WOX13(2)               <---------WOX13(2) <---------AHL12(2)
---AHL20(2) --------->ARR11(3)   <---------WOX13(2)               --------->WOX13(2)<---------AHL12(2)
->AHL25(3)  <---------ARR11(3)  --------->YAB5         ----------->RAV1(1)        --------->AHL25(1)
-------AHL20(2)               ------------>CBF        --------->MYB46(3)   ----------->RAV1(1)------
 
ttttttacactgtaacatctcttatatttaagaaacaattaaagtaaataaagctcaacaacaaaaactaattaagcccaacaaaataaataaaccatca  114100
                                                                                                  --
                     ----------->GT1                                                        --------
                    ----------->GT1       ----------------->AGL1                        <---------ANAC58
             --------->At5g28300    <---------AHL12(1)                             --------->ARR11(3)
       <-----------GT1              --------->AHL20(2)                             --------->GATA12
    --------->ANAC55(2)             --------->AHL25(2)                             <---------GATA12
----->ZmHOX2a(1)  --------->TOE2(2) <---------AHL20(2)                             <---------GLK1(2)
------->TOE2(3)   --------->TOE1(2) <---------AHL25(2)                             <---------RVE1(2)
------YAB1  ----------->GT1         --------->AHL12(1)                             <---------ARR11(3)
--->YAB1 --------->ZAT6    <---------AHL12(2)                             <-------TEIL  <---------ANAC58
 
tccttatatgtaacactgtaacatgggaaaaaaaaacaattttttgcccaaatgtataagaaatttgtataacaaaattcatactagattttcttgttgt  114200
                                                        ----------->GT1
                                                       --------->DAG2
                                            <---------AHL25(2)                                    --
                                            --------->AHL25(2)                                    <-
                                            <---------AHL25(3)                   --------->AHL20(3)
                                           --------->AHL20(2)                    <---------AHL12(3)
                                           <---------AHL12(3)              <----------DOF2      ----
                                          <---------AHL12(2)       ---------->DOF2   <-----------GT1
                                          --------->AHL12(2)    <-----------GT1  <---------AHL20(2)
                              ----------->GT1         ---------->DOF2      <---------DAG2     ------
------->ICU4             <----------DOF2 --------->AHL20(3)  --------->AHL12(2)  --------->AHL12(3)
-->ID1             ----------->GT1       --------->AHL20(2)  <---------AHL12(2)  <---------AHL20(3)<
 
aattcttggtatacaaaatgaaaggtttctttgttgtaaaacaaaaatatatgtactaaaagtaattttacaaagtcgctttatatttttacatttagaa  114300
                                 <-----------GT1                                                  --
                              --------->WOX13(2)                                                <---
                        --------->WOX13(2)                                                      ----
--------->ATHB12        <---------WOX13(2)                                                 ---------
------->ARR11(3)       --------->ATHB12       --------->ICU4                           <---------AHL12(3)
--------ARR11(3)     <----------DOF2          --------->DOF5.7(1)     <-----------HVH21--------->AHL20(2)
----->DOF5.7(1)     --------->TOE2(3)       ---------->DOF2<---------ZAT6              --------->AHL25(2)
---->DOF2   --------->ALFIN1  <---------WOX13(2)  ----------->GT1    <---------ZAT6    <---------AHL25(1)
------ZmHOX2a(2) --------->GLK1(1)  ---------->DOF2      ----------->GT1               <---------AHL25(2)
 
agatcatttgatcaagtgggaaacctttattgaaattaacaaagtggaaaagattgtaagtagtgaaatttagtgtcatctatagacaaaaaaaatgtaa  114400
                                                                        ----------->GT1
                                                                      <---------ZAT14
                                                                      --------->ZAT14
                                                             <---------AHL25(2)
                                                             <---------AHL12(2)
                                                             --------->AHL12(2)
                                       <------MYB46(1)       <---------AHL12(3)                <----
                                       <------MYB83          --------->AHL25(2)                -----
                             --------->KAN1                  --------->AHL12(3)                <----
                      <---------MYB52(1)           <---------ZAT14 <---------At5g28300        ------
           <---------KAN1   <---------KAN1         --------->ZAT14<-----------GT1           --------
        <------ZmHOX2a(1) <------ZmHOX2a(1) <---------WOX13(2) <---------ICU4               <-------
   <---------KAN1     --------->ARR11(2)    --------->WOX13(2)--------->ICU4                <-------
------->YAB1          <---------ARR11(2)   --------->ATHB12 --------->YAB1            --------->ZAT14
------WOX13(2)       <-------GAMYB    <---------TOE2(3)     --------->AHL20(2)        <---------ZAT14
----->WOX13(2)     --------->MYB59    --------->MYB59     <---------WOX13(2)     <---------ZAT14
-->GT1<---------TOE2(3)  <---------YAB1----------->GT1    --------->WOX13(2)     --------->ZAT14
 
attagaatttaggaatatgaattcggttaggattagtcgattaggtttattgagtaaactcaataaaaattactgtagtaatacttcagtactcggttcg  114500
<- Previous    Next ->

AGI:  At4g00250.1   
Description:  DNA-binding storekeeper protein-related. similar to DNA-binding storekeeper protein-related [Arabidopsis thaliana] (TAIR:AT4G00238.1); similar to unknown [Populus trichocarpa] (GB:ABK93310.1); contains InterPro domain Protein of unknown function DUF573 (InterPro:IPR007592)
Range:  from: 112705    to: 113966    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version