AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  <---------WRKY38(1)
                                               <---------MYB46(3)
                                            <---------bZIP60(2)
                                            <---------ANAC46
                                --------->SPL7(1) <---------WRKY12
                     --------->ANAC46      --------->ALFIN1                                 --------
                     --------->O2      --------->At4g35610                                  <-------
                     --------->bZIP60(2)<---------MYB52(1)                               <---------RVE1(2)
                     --------->ANAC58  --------->LBD16<---------DOF5.7(1)     <---------AHL20(1)
                     --------->ANAC55(2)<-----------HVH21                     --------->AHL20(1)
                     <---------O2      <---------At4g35610                   <---------AHL12(2)
            <---------WOX13(1) --------->MYB52(1) <---------WRKY45           --------->AHL12(2)
      --------->ARR11(2)      ------>NtERF2<---------AtMYB61                 --------->AHL12(3)
     <---------GLK1(1)       <---------ETT(1) <---------AtMYB61              <---------AHL12(3)    -
---------->DOF2      --------->ANAC58--------->SPL7(1)<----------DOF2       --------->AHL20(1)     <
------>TOE2(3)  --------->bZIP60(1)<-----------HVH21  <---------DAG2        <---------AHL20(1)     -
---GT1<---------ARR11(2)     ----------->HVH21--------->ALFIN1              <---------ARR11(3)    <-
 
cattaaagctatccgattgatgccacgtagtcccgaccggtccggtgaggtggtcaactttttgtatacctggtttcaatatatattacttcgatatgta  23410000
                                                                      --------->GLK1(1)
                                                                      --------->CCA1(2)
                                                                     --------->ARR11(2)
                                                                     --------->ARR11(3)
                                                                     --------->ARR11(1)
           <---------ALFIN1                                          <---------ARR11(2)
          --------->ANAC46                                           <---------ARR14(2)
       --------->MYB46(3)                                 <----------DOF2
       ====================================HOX2a_HOX2a   --------->HSFC1(2)
      =====================================HOX2a_HOX2a   <---------HSFC1(2)
      <------ZmHOX2a(2)                                  --------->HSFB2a(1)
     --------->PCF2                                      <---------HSFB2a(1)
     --------->ARR14(2)                                <---------ARR11(2)
     <---------GATA12                                  --------->ARR11(2)
     --------->ARR11(2)                                --------->ARR14(2)
     --------->GATA12                               <---------ANAC55(2)
     <---------ARR11(2)                             --------->HSFB2a(2)            ------>ZmHOX2a(1)
     <---------ARR14(2)                             <---------HSFB2a(2)           <-----------------AGL1
--------->TOE1(2)                                   --------->ANAC55(2)       <---------DOF5.7(1)
--->GT1------>ZmHOX2a(2)                           <---------------------WRI1<---------DOF5.7(1)
--ANAC55(2)----------->RAV1(1)                     <---------LBD16   <---------RVE1(2)
-------->YAB1                       ------>ZmHOX2a(1)--------->LBD16 <---------ARR11(3)
---------ICU4             --------->TOE1(3)      --------->ARR14(2)  --------->ARR14(2)
-------->ATHB12           --------->TOE2(3)      <---------ARR14(2)----------->ARR10
--------ATHB12         <-----------GT1 ---------->DOF2 <---------ARR14(2)  ------->TEIL   ----------
 
aatcatgggatccaccacatacgattttaccttaatctcctcaaaagtataagttccggaactttctaagaagatatgcacccttcctccctctggtaaa  23410100
                                                                     <---------AHL12(3)
                                                                     ----------->TBP
                                                                     <---------AHL20(2)
                                                                   <---------AHL12(3)
                                                                   --------->AHL20(2)
                                                                   ----------->TBP
                                                                 --------->AHL12(3)
                                                                 <---------AHL12(3)
                                                                 <---------AHL20(2)       ==========
                                                          --------->ANAC46                <---------ANAC58
                  <---------ALFIN1                        --------->ANAC58                <---------ANAC58
       --------->HSFC1(2)                           --------->ZAT2 <---------AHL20(2)     --------->TGA1a
       <---------HSFB2a(1)                          <---------At4g35610                   <---------O2
       --------->HSFB2a(1)                          <---------ZAT2 --------->AHL12(3)     --------->O2
       <---------HSFC1(2)                           --------->At4g35610                   <---------TGA1a
  --------->HSFC1(1)                        <------ZmHOX2a(1)    --------->AHL20(2)      ------>MYB83
  <---------HSFC1(1)                      <---------TOE2(3)      ----------->TBP         ------>MYB46(1)
  <---------HSFB2a(2)                     <---------TOE1(3)--------->LBD16             --------->TOE2(2)
  --------->HSFB2a(2)                  <---------AHL20(2) --------->ANAC58  <---------GATA12
->GT1---------->DOF2           ---------->DOF2<------ZmHOX2a(2)----------->TBP   --------->ANAC46<--
 
tagctctagaaagttcgaactccacttggtgactaaaagaattttaaggatcaccagctccccgctatatatatatatggatttaagtcacctacgtggc  23410200
                          ------->GAMYB
                         --------->MYB46(3)
                         <---------MYB55(2)         ----------->RAV1(1)
                        <---------ZAT2              --------->ANAC58
                        --------->ZAT2              --------->ANAC46
                        --------->At4g35610         --------->ANAC58
                       <---------ALFIN1          --------->MYB52(1)
                       --------->MYB52(1)       ------->GAMYB
                 ------>ZmHOX2a(1)             <---------MYB55(2)
               <---------ANAC58                --------->MYB46(3)
               <---------ANAC58               -------->P
            --------->GLK1(1)                --------->MYB52(1)   --------->ZAT18
        ===================RAV             <---------MYB111(1)    --------->ZAT14
        <---------ALFIN1<---------At4g35610<---------MYB46(2)     <---------ZAT14
        ----------->RAV1(1)                <---------MYB59      --------->ZAT14                    <
     --------->ANAC46 <---------ALFIN1     <---------MYB52(2)   <---------ZAT18                   <-
==================================MYC_MYB --------->WOX13(2)    <---------ZAT14   --------->AHL20(2)
----------CBF  ----------->RAV1(2)       <-----------GT1---------->DOF2     ---------->DOF2       <-
 
cattgtcttcgccacatttcctgccccaactgccataaactaagtaactaaccaccagcaaaagcagagtactctgttttaaagaaaaaatacacttccc  23410300
                                                                                   <-----------GT1
                                                                                --------->WOX13(2)
                                                                                <---------WOX13(2)
                                                                              <---------YAB1
                                                                              --------->AHL25(3)
                                                                             <---------AHL25(2)
                                                                             --------->AHL12(2)
                                                                             <---------AHL20(2)
             --------->ARR11(2)                                              <---------AHL20(3)
       <----------DOF2                                                       --------->AHL25(1)
      <---------DOF5.7(1)                                                    --------->AHL20(3)
    --------------->AGL15                    --------->ARR14(2)              --------->AHL25(2)  <--
    <---------------AGL15                    <---------ARR11(2)             --------->YAB1       <--
   <-----------------AGL2          <-----------------AGL1     --------->ARR11(2)<---------AHL12(2)
   <-----------------AGL3          ------------>CBF    <-------TEIL    <---------TOE1(2)       -----
<----------DOF2           <---------AtMYB61  --------->ARR11(2)      <---------ANAC58        -------
---------DOF5.7(1)   <----------DOF2         <---------ARR14(2)      <---------ANAC46      ---------
--------DOF5.7(1)  <---------At4g35610      <------ZmHOX2a(1) <---------ARR11(2)--------->AHL12(2)--
---------DOF2<---------ARR11(2)    ----------------->AGL1------->TEIL<---------ANAC58--------->ANAC46
 
gctctttcttcttttggttctgtgctgttttggtcttctccaatacaggaaccccaaatgcatcgtttccttccttggattataatttacgaaaaatcca  23410400
                                                                                   <-------PIF5
                                                                                   <---------MYB52(1)
                                                                                   --------->ATERF1(1)
                                                                                   ------->PIF5
                                                                                  <---------ATERF1(1)
                                                                                  <---------DEAR4(2)
                                                                                  <---------DEAR3(2)
                                                                                 <---------DEAR3(1)
                                                                                 <---------ATERF1(2)
                                                                                 --------->DEAR3(1)
                                                                               ------>NtERF2
                                                                               --------->ABI4(1)
                                                                              ------->GAMYB
                                                                              --------->DREB2C(2)
                                                                              --------->DEAR3(1)
                                                                              <---------ALFIN1
                                                                             --------->DEAR4(2)
                                                                             --------->DEAR3(2)
     --------->YAB5                                                          <------NtERF2
     --------->ATHB12                                                       <---------ATERF1(1)
    <------ZmHOX2a(2)                                               --------->WRKY18(1)
   --------->ARR11(3)                                              <-----------HVH21
   <---------ARR11(3)                                              <--------ZAP1 --------->ATERF1(2)
-------YAB5                                                   --------->ZAT14--------->ATERF1(1)
-------ATHB12                                        --------->ANAC58<---------WRKY38(1)
---->WOX13(1)                                        --------->ANAC58<---------WRKY12------>NtERF2
----->CBF                 <------------CBF      <---------ETT(2)   --------->At5g28300
>RVE1(2)                <---------YAB1      --------->MYB46(3)<---------ZAT14--------->MYB46(3)
------->YAB1    --------->HSFB2a(2)       ------->TEIL     --------->LBD16  ------>NtERF2
 
atcatagatcattagacttctagcattagcattgctaacaagatggacccgtcgtcaagctccagagcacggtcaatgccaccgccggtgcctatggagg  23410500
                                                       ------>ZmHOX2a(2)
                                                 <------MYB46(1)
                                                --------->MYB46(2)
                                                <---------AtMYB61
                                                <---------MYB46(3)
                                                --------->MYB55(2)
                                                --------->MYB111(1)
                                                <---------DEAR3(1)
                                                --------->MYB111(2)
                                               <--------P
                                               <---------MYB55(1)
                                              <-------GAMYB
                                             --------->ATHB12
                                --------->DOF5.7(1)  <---------GATA12        <---------ANAC46
                    <---------DOF5.7(1)     <---------AtMYB61                <---------ANAC58
              <---------DOF5.7(1)  --------->KAN1<------MYB83                <---------ANAC58
       <---------ZAT2         ---------->DOF2<---------MYB46(3) --------->ANAC58                   <
       --------->ZAT2<---------DOF5.7(1)<---------HSFB2a(2)     --------->ANAC58            <------NtERF2
    <------ZmHOX2a(1)<----------DOF2    --------->HSFB2a(2)     --------->ANAC46    <-----------RAV1(2)
 
gattgcaggaagcagggccttctccttttctaacaaagacgttcgagatggttggtgatccaaacacaaaccacattgtgtcttggaacaggggaggcat  23410600
                <---------ALFIN1
               ------>ZmHOX2a(2)
              <------ZmHOX2a(2)
             <---------GATA12
             <---------ARR11(2)
             --------->ARR11(2)
             <---------ARR14(2)
             --------->GATA12
             --------->PCF2
             --------->ARR14(2)
            <---------PCF2
         --------->ALFIN1
       --------->ALFIN1
       <---------ANAC46             --------->ZAT14           --------->MYB46(3)
     <---------ANAC46         ------>NtERF2              --------->YAB1       <-----------HVH21
     <---------ANAC58        --------->ANAC46          --------->ANAC58    <----------DOF2
     <---------ANAC58      --------->HSFB2a(2)         --------->ANAC58  --------->ZAT2
---------MYB52(1) --------->KAN1    <---------ZAT14  ---------->DOF2     <---------ZAT2     --------
 
cagttttgtcgtgtgggatccacattccttctcggccactattctgcctctatacttcaagcacaacaacttctccagctttgtcagacaacttaacact  23410700
     <---------ARR11(3)
     --------->ARR14(2)
     <---------ARR11(2)
     <---------ARR14(2)                                        <---------ZAT6               --------
     --------->RVE1(2)                                     <---------ZAT14                  --------
     <-----------ARR10                                 <-----------GT1            <---------ANAC58
     --------->ARR11(3)                                --------->ZAT6             <---------ANAC58
     --------->GLK1(2)       <---------MYB59         <-----------GT1  <---------MYB52(1)   ---------
    <---------KAN1           <---------DOF5.7(1)--------->AHL12(2)   --------->TOE2(3)   <------ZmHOX2a(1)
->ZAT6              --------->ANAC46         ---------->ID1--------->ZAT14        <---------ANAC46
 
tatgtgagtatctctgtttctccactaaacgaccttactgtattttttgttttttttttcactatagtgttcccttaatcttatgtcttggaggaactca  23410800
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                  --
                                                                                                  --
                                                                                                 <--
                           ----------->GT1                                                <---------YAB1
                          --------->DOF5.7(1)                                           --------->KAN1
                    --------------->AGL15                                               --------->YAB1
                    <---------------AGL15                    --------->ZAT14            <---------ICU4
                  <---------At5g28300                        <---------ZAT14            -------->HAHB4
                 <---------ICU4                              --------->ZAT18           --------->ICU4
               --------->WOX13(2)                       <---------ANAC46               <---------YAB5
               <---------WOX13(2)                       <---------ANAC58               <---------ATHB51
             <---------AHL20(2)                         <---------ANAC58              <---------WOX13(2)
             --------->AHL20(2)                         <---------ANAC55(2)           --------->WOX13(2)
->ANAC58   <----------DOF2--------->DAG2                <---------ANAC55(1)         --------->AHL20(2)
->ANAC58  <---------DOF5.7(1)                           --------->ANAC55(2)         <---------AHL20(2)
>GLK1(1)------>NtERF2   ---------->DOF2               <-----------GT1     <---------------AtSPL8 <--
 
acaatgccttcggcctttaattactgcaaaaggttaaacaatgtgtctatttgtgaattacttgttcactggatagtttagtactaagtaattatgctca  23410900
<- Previous    Next ->

AGI:  At3g63350.1   
Description:  AT-HSFA7B (Arabidopsis thaliana heat shock transcription factor A7B); DNA binding / transcription factor. Identical to Heat stress transcription factor A-7b (HSFA7B) [Arabidopsis Thaliana] (GB:Q9M1V5); similar to AT-HSFA7A (Arabidopsis thaliana heat shock transcription factor A7A), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT3G51910.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22596.1); contains InterPro domain Winged helix repressor DNA-binding (InterPro:IPR011991); contains InterPro domain Heat shock factor (HSF)-type, DNA-binding; (InterPro:IPR000232)
Range:  from: 23410443    to: 23411787    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version