AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                 <---------ATHB12
                                --------->ANAC58
                                --------->ANAC58
                           --------->ANAC58
                           --------->ANAC58
-->MYB52(1)       --------->DOF5.7(1)                   --------->YAB1             <-----------GT1
-MYB59  <------ZmHOX2a(1)<------ZmHOX2a(1)       <---------KAN1             <-------TEIL ------->GAMYB
 
tgtatcaagaaggagagtcttaagagcaggaagccaagcattcttagggagaatgtcaataacaaaaccagaccctagtttcattttcacaacgctcttg  23105900
                                                                                                ----
                                                                                             -------
                                                                                             -------
                                                                      --------->ANAC46       <------
                                                                      --------->ANAC58       <------
       ------>ZmHOX2a(2)                                            <---------ALFIN1         -------
       ===============================HOX2a_HOX2a                  --------->ZAT14           -------
      ================================HOX2a_HOX2a                 <---------ALFIN1           -------
      <---------GLK1(1)                                 --------->CCA1(2)                   <-------
      <------ZmHOX2a(2)                                 <------ZmHOX2a(2)                   --------
     <---------GATA12                                  <---------ARR11(3)                   <-------
     --------->GATA12                                  --------->ARR11(3)                 --------->WOX13(1)
     <---------AGP1                                    --------->ARR14(2)             <---------ARR11(2)
     --------->ARR14(2)                                --------->ARR11(2)          <---------ANAC58
     --------->ARR11(3)                                <---------ARR11(2)          <---------ANAC55(2)
     <---------ARR14(3)                                --------->RVE1(2)           --------->ANAC55(2)
     --------->ARR14(3)          ----------->HVH21     --------->AGP1 --------->ANAC58--------->ARR11(2)
     <-----------ARR10         ================================HOX2a_HOX2a         <---------ANAC58
     <---------ARR11(3)        ------>ZmHOX2a(1)       <---------ARR14(2)          <---------ANAC46
     <---------ARR14(2)        --------->At4g35610     --------->GATA12     <---------ALFIN1<-------
     --------->RVE1(2)         <---------At4g35610     <---------GATA12   ----------->RAV1(1)<------
 
caagtgaagatctcagaaggcagtgagtaatctcctctgacattgatgtccagttcaagatccaagactccacactccaacacattgcgtaaacaatcat  23106000
------->HVH21                                             ----------->HVH21
-->YAB5                                                   --------->WRKY38(1)
-->YAB1                                         ----------------->AGL1
--ATHB1                                      <---------KAN1
------ATHB5                                 --------->GLK1(2)                              ---------
-->ATHB51                                   --------->RVE1(2)                           <------ZmHOX2a(2)
->ATHB1                                     --------->ARR14(2)                         --------->GATA12
-->ATHB12                                   <---------ARR14(2)                   --------->KAN1
--YAB1                                      <---------GATA12                    <---------YAB1
->ICU4                                      --------->GATA12             --------->At4g35610
--YAB5                                     <---------GLK1(2) <---------ANAC46  --------->TOE2(3)
--ATHB12                          --------->TOE2(3)      --------->At5g28300  --------->YAB1    ----
---ICU4                           <----------DOF2 ------>ZmHOX2a(1)      <---------At4g35610    <---
 
tgacagttttatactgagcaaaattcaaagactgcaactttagagagaatctcctaatacggtgactggcaagtcgagctaacattattcgatcagcgaa  23106100
                                   --------->MYB52(1)
                                 <---------YAB5
                           ------>NtERF2
                          --------->DEAR3(1)
                         <------NtERF2                                        <---------ARR14(2)
                        ------>NtERF2 ------->GAMYB                           --------->ARR14(2)
                       --------->ANAC46                             <---------GLK1(2)
                      --------->ATERF1(1)                           --------->ARR11(2)
                      --------->SPL7(1)                             <---------ARR11(2)
                     --------->At4g35610                            --------->GATA12
                     <---------ATERF1(1)                            <---------GATA12
                     <---------At4g35610                            --------->ARR14(2)           ---
>At4g35610   --------->ICU4--------->LBD16                          <---------ARR14(2)           ---
----->ARR11(3)--------->MYB52(1) <---------KAN1                 ----------------->AGL2           ---
------ARR11(3)<---------ICU4  <------ZmHOX2a(1)        <---------YAB1 <-------TEIL             -----
 
atctttgaaacttgcactaatggcagacgccgaggaatcaacgaaaacagcaatcggtatgatggtaaccagattcagccagttcttggaggtatacttc  23106200
                                 --------->ANAC46
                                 <---------ANAC55(2)
                                 --------->ANAC58
                                 --------->ANAC58
                              <------ZmHOX2a(2)                  <---------GLK1(2)
         <---------DOF5.7(1) <---------GATA12                   --------->YAB5
     --------->HSFC1(2)      --------->ARR11(3)                <---------YAB5
     <---------HSFC1(2)      <---------ARR11(3)           --------->AHL12(2)                --------
------>ANAC46               <---------GLK1(1)             <---------WOX13(2)             --------->TOE1(3)
------>ANAC58               --------->GLK1(1)             --------->WOX13(2)             --------->TOE2(3)
------>ANAC58   --------->ETT(2) --------->ANAC55(2) ----------->GT1          <----------DOF2
----->DOF2<----------DOF2 <------ZmHOX2a(1)  --------->ZAT6 <-----------GT1  <---------DOF5.7(1)
 
aagcaagtagcttcttttgtcgaaagtaaggagatcacgcgatagataacaccatctggtaaattactgattctatccattcttttctcaaaccctaaag  23106300
                                                  <---------ANAC58
                                                  <---------ANAC58     --------->KAN1
                                                  <---------O2      ------->GAMYB
                                         --------->TOE1(3)          --------->YAB1
                                        --------->HSFB2a(1)         --------->TOE2(3)
               --------->LBD16        --------->ARR11(2)           --------->MYB46(3) <------ZmHOX2a(2)
       --------->ZAT6                 <---------ARR11(2)          -------->P          ------------>CBF
   <----------DOF2      ------------>CBF--------->HSFC1(2)       --------->WOX13(1)  <---------ARR11(3)
  <---------DOF5.7(1)  --------->TOE2(3)<---------HSFB2a(1)   --------->RVE1(2)      --------->RVE1(2)
-->DOF2<-----------GT1 --------->TOE1(3)<---------HSFC1(2)    --------->TOE2(3)      --------->GATA12
 
aaccctcttttcactacccagaaaaacctcaatttctaatggaaccttcagtgacttgacttcaacatcaaccaaaattcccaaactagatcaatttcaa  23106400
                                                                      <---------ARR11(2)
                                                              <---------ARR11(2)
                                                <---------ICU4--------->ARR11(2)
                                                --------->YAB1--------->ARR14(2)
                                               <---------YAB5 <---------ARR14(2)       ----------->GT1
                                        --------->TOE1(2)   <----------DOF2--------->ANAC58
                                        --------------------->WRI1    --------->ARR14(2)
                                <---------At4g35610        <---------ANAC46--------->ANAC58
        --------->ZAT2          --------->At4g35610 ------------>CBF  <---------ARR14(2)   ---------
        --------->At4g35610 <---------KAN1     <---------ATHB12       --------->ARR11(2)   <--------
 
aggctaagacgagcttacttcacatgtaggcatgaagcagaaacctagaaatcatcgcaatcgcgtttatgcagaaccaagaaaaccgaagcgtaatttg  23106500
                                                                                                 ---
                                                                                                 <--
                                                                                                ----
                             <------ZmHOX2a(2)                       --------->YAB1            -----
                    ------------>CBF                            ------------>CBF               -----
        <--------P --------->ANAC58                    <------------CBF                        <----
      <---------ANAC46       <---------ATHB12          <---------WOX13(2)                      <----
 <------------CBF  --------->ANAC46       --------->GLK1(1) --------->GATA12                  ------
>WOX13(2)          --------->ANAC58       <---------GLK1(1) ------->TEIL                   <--------
-WOX13(2)   --------->ANAC46 ------------>CBF    XXXXXXXXXXXXXXXXXXXXXXX>MIR163         ---------->DOF2
 
cagaaattggggtagacgagacactcaatccgatcaatttgagagatttctgaagcgaaattgaatcttcaatgagaaatggacgaagaagtagagcgga  23106600
                                                    --------->WOX13(2)
                                                    <---------WOX13(2)
                                                    <---------AHL12(2)
                                                   <---------AHL25(1)
                                                   <---------AHL20(3)
                                                   <---------AHL25(2)
                                                   <---------AHL12(3)
                                                   --------->AHL20(3)
                                                   <---------AHL25(3)
                                                   --------->AHL12(3)
                                                   <---------AHL20(2)
                                                  <---------AHL20(2)
                                                  --------->AHL25(1)
                                                  --------->AHL25(3)
                                                  --------->AHL20(2)
                                       <---------YAB1
                                      <---------AHL12(3)
         <---------ANAC58             --------->AHL12(3)
------------>AtSPL3                   --------->AHL25(2)                                      <-----
----NtERF2               --------->ANAC58   --------->RVE1(2)                  --------->CCA1(2)
-->NtERF2<---------ANAC58--------->ANAC58--------->WOX13(2)                   --------->ARR14(2)
---->ARR14(2)          ---------->DOF2<---------AHL25(2)                      <---------ARR14(2)
---->ARR11(2)         <------ZmHOX2a(1)<---------AHL20(2)                     <---------ARR11(2)
-----ARR11(2)      --------->At4g35610<---------AHL12(2)                      --------->ARR11(2) ---
-----ARR14(2)   --------->At4g35610   --------->AHL12(2)                  <---------LBD16     <-----
--->ATERF1(1)   <---------ZAT14     --------->AHL12(1)                 --------->KAN1        <------
-At4g35610      <---------At4g35610 <---------AHL12(1)             --------->AHL20(2)        <------
 
gccgtagcattttcttgagagcagaggaaagaaatttgaatttttattatctattaattttgctcattttttatatactcggatacaaaaacaaaacctt  23106700
                                                                                            <------MYB83
                                                                                            <------MYB46(1)
                                                                                           ---------
                                                                                       <---------AHL25(3)
                                                                                       <---------AHL12(1)
                                                                                       --------->AHL12(1)
                         ----------->RAV1(2)                                           --------->AHL20(2)
                        ------>NtERF2  --------->ANAC58                                <---------AHL25(1)
                       <---------ALFIN1--------->ANAC58                                --------->ATHB51
                       --------->DEAR3(1)                                              --------->ATHB12
                      --------->ORA47(2)                                               <---------AHL20(2)
                      --------->ATERF1(1)    <<<<<<<<<SARD1                            --------->AHL25(1)
                     ------>NtERF2 <------NtERF2                <--------P            --------->AHL12(1)
                     <---------RAP2.3(1)     <<<<<<<<<CBP60g   <-------GAMYB          --------->AHL25(3)
                    --------->ANAC46 <---------ALFIN1         ----------->GT1         <---------AHL12(1)
             <--------HAHB4        ------>NtERF2              <---------ANAC46        <---------YAB5
-----DOF2    --------->YAB1       --------->ANAC46         --------->ALFIN1  <---------RVE1(2)
------->ID1 <---------YAB5        --------->ANAC58       <-----------RAV1(1) <---------GLK1(2)
----DOF5.7(1)<---------ICU4       --------->ANAC58     <---------ANAC46      --------->ARR11(3)
---DOF5.7(1)<---------ATHB12     --------->ZAT18     --------->ZAT14         --------->GATA12
---DAG2   --------->WOX13(1)     <---------ZAT18     <---------ZAT14         <---------ARR11(3)
 
ttcgtttttgagccaatcattttgcgccacctgtagtccgccactccaaatttcggtttagtgtggggttgaattgtttagatttttgaattatttggta  23106800
<- Previous    Next ->

AGI:  At3g62430.1   
Description:  F-box family protein. Identical to Putative F-box protein At3g62430 [Arabidopsis Thaliana] (GB:Q9LZP7); similar to syntaxin-related family protein [Arabidopsis thaliana] (TAIR:AT3G54160.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO63569.1); contains InterPro domain Leucine-rich repeat 2 (InterPro:IPR013101); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810); contains InterPro domain FBD-like (InterPro:IPR006566)
Range:  from: 23104771    to: 23106280    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version