AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                              --------->WOX13(2)
                                                                            --------->AHL20(2)
                                                                            <---------AHL20(2)
                                                                            <---------AHL12(1)
                                                                            --------->AHL25(1)
                                                                            --------->AHL25(3)
                                                                            --------->AHL12(1)
                                                                           --------->AHL12(3)
                                                                           <---------AHL12(2)
                                                                           <---------AHL12(3)
                                                                           --------->AHL25(3)
                                                                           --------->AHL25(2)
                                                                           --------->AHL12(2)
                                                                           <---------AHL25(2)
                                                                          --------->YAB1
                                                                        --------->AHL20(1)
                                                                        <---------AHL12(2)
                                                                       --------->YAB1
                                                                       --------->AHL12(3)
                                                                       --------->AHL20(2)
                                                                       <---------AHL25(3)
                                                                       <---------AHL25(2)
                                                                       <---------AHL12(3)
                                                                ------>MYB46(1) <-----------GT1
                                                                ----------->RAV1(1)
                                                           <---------ARR11(2) <---------WOX13(2)
                                                      <---------ARR11(2)<---------AHL20(3)
                                                      <---------GATA12 --------->AHL25(2)
                                                      --------->ARR14(2)--------->AHL25(2)
                                                      --------->ARR11(2)<---------AHL12(3)       <--
-------ARR11(3)                                       <---------ARR14(2)--------->AHL20(3)      ----
------>ARR11(3)                                   <---------LBD16      --------->AHL25(1)   --------
------>RVE1(2)                                   --------->MYB52(1)    <---------AHL25(1)<---------ANAC58
----->GLK1(1)                                   ----------->HVH21 --------->MYB46(3)     <---------ANAC58
--->YAB1                                        --------->WRKY12------>MYB83<---------AHL25(1) <----
---YAB1                                 ----------->GT1    --------->ARR11(2)<---------ICU4 <-------
-ICU4      <---------YAB5              --------->ANAC58 ------>ZmHOX2a(2) --------->TOE2(3) <-------
>YAB1------->TEIL       ------->TEIL   --------->ANAC58<------ZmHOX2a(2)<---------AHL25(2) ---------
 
tatctatgtatgtagtcatggtatatgaattttgaaattggcaaggtaacattgacggatcgtaacccaacaaataatattaattacaaaatgggtgggc  22905800
                                             <---------KAN1
                                             --------->CCA1(2)
                                            --------->ARR14(2)
                                            <---------RVE1(2)
----NtERF2                                  <---------ARR14(2)          --------->YAB1
----->LBD16                 <---------DAG2  --------->ARR11(2)       --------->YAB1
->MYB55(2)                  <----------DOF2 <---------ARR11(2)      <-------TEIL----------->GT1
-----ANAC46     <---------ICU4             <------ZmHOX2a(1)       --------->AtLEC2 <---------AHL20(2)
--MYB46(3)     --------->ICU4        <--------HAHB4           --------->YAB1 --------->DOF5.7(1)
--DEAR3(1)     <---------YAB1       <---------YAB1           <---------YAB5--------->YAB1
>ALFIN1      --------->YAB1 <---------DOF5.7(1)       --------->DOF5.7(1)  ---------->DOF2
 
gggaatagtatacaactcataattccactcactttttgtattattaggatatgaaataagagtaatcaacatgcataataaagatgtataatttcttcat  22905900
                                                                                  --------->ATHB12
                                                                                  --------->YAB5
                                                                                  -------->HAHB4
                                                                                  <---------ICU4
                                                                                 --------->ICU4
                                                                            <---------ANAC55(2)
                                                                            --------->ANAC58
                                                                            --------->ANAC58
                                               ---------->DOF2              --------->ANAC55(2)
                                               --------->DOF5.7(1)          --------->ANAC46
                                      <---------DOF5.7(1)                 <-----------GT1
                                     <---------DOF5.7(1)                --------->WOX13(2)
                                     <----------DOF2               --------->ANAC58             ----
                                    <---------DAG2      <-----------GT1 <---------WOX13(2)    <-----
                ----------->GT1  <-----------GT1--------->DAG2     --------->ANAC46    <---------ANAC58
     --------->YAB1      --------->ANAC46  --------->YAB1          --------->ANAC58    <---------ANAC58
 
cttaaaaaacataactacatggtttaatacacaattttaccttttatcaaaaaagtatttcacaattcactcgcaaattacgaaatgatggctagtgctt  22906000
                  --------->AHL20(2)
                 <---------AHL20(2)
               <---------AHL12(2)
              --------->AHL25(2)
              --------->AHL12(1)                                                      <---------WOX13(2)
              <---------AHL25(2)                                                      --------->WOX13(2)
              <---------AHL12(1)                            <---------ICU4       --------->WOX13(1)
              --------->AHL20(1)                            --------->YAB5     <---------ATHB12
              <---------AHL20(1)                           <---------YAB5      --------->MYB46(3)
              <---------ARR11(3)                           <---------ATHB12   -------->P
              --------->ARR11(3)                    --------->ARR14(2)        --------->ANAC58
              --------->AHL20(3)                    <---------RVE1(2)--------->WOX13(2) <---------AHL20(2)
              <---------AHL20(3)           --------->WOX13(2)        <---------WOX13(2) --------->AHL20(2)
             <---------KAN1   --------->ALFIN1      <---------ARR14(2)        ------>MYB46(1)
     <<<<<<<<<SARD1         <---------ANAC46  <-----------GT1      <---------AHL20(2)----------->GT1
     <<<<<<<<<CBP60g   --------->YAB1  <----------DOF2   <---------ICU4       --------->ANAC58
----->REM1(1)<---------AHL12(1)       <---------DAG2<---------ARR11(2)        ------>MYB83<---------WOX13(2)
-----DOF2    --------->AHL12(1)--------->REM1(2)    --------->ARR11(2)      --------->DEAR3(1)    --
 
caactccaaatttcgaatattttaaatcacgatgtgtagaaccttttatttactggatactaatcactagtttattgagccaaccaattagttaaataga  22906100
                                   --------->AHL20(2)
                                   <---------AHL25(1)
                                   <---------AHL12(1)
                                   --------->AHL12(1)
                                   --------->AHL12(3)
                                   --------->AHL25(1)
                                   <---------AHL12(3)
                                   <---------AHL25(3)
                                  --------->AHL12(2)
                                  --------->AHL20(1)
                                  <---------AHL20(1)
                                  --------->AHL25(2)
                                  <---------ARR11(3)
                                 <---------AHL12(3)
                   --------->AHL12(3)            ------>NtERF2
                   <---------AHL12(2)           <---------PCF2
                   --------->AHL12(2)           <---------PCF5
                   <---------AHL12(3)        --------->ALFIN1
                  <---------AHL25(2) <---------AHL12(2)
                  --------->AHL25(2)<---------AHL25(3)
                 <---------CCA1(1)--------->ARR11(3)
                <---------ARR11(3)<---------AHL12(1)
      <---------YAB1             --------->AHL12(3)                                        ---------
     <---------AHL20(3)          --------->AHL12(2)                                        ---------
     --------->AHL25(2)    <----------DOF2  --------->DOF5.7(1)                            <--------
     <---------AHL25(2)   --------->TOE2(3)--------->DOF5.7(1)                         <---------YAB1
     --------->AHL20(2) ---------->ID1   ---------->DOF2                              --------->AHL20(3)
     --------->AHL20(3)<-----------GT1 <---------AHL20(2)                             <---------AHL20(3)
   --------->ICU4<---------RVE1(1)--------->AHL12(1)                                 <---------ICU4
 --------->YAB1 --------->ARR14(2)<---------AHL12(2)                                --------->ICU4
 --------->YAB5 <---------ARR14(2)<---------AHL25(2)                    --------->ANAC58  <---------YAB1
<---------ATHB12--------->ARR11(3)--------->AHL25(3)     --------->DOF5.7(1)        <---------YAB1
------->WOX13(1)<---------RVE1(2)<---------AHL25(2)    ---------->DOF2  --------->ANAC58--------->YAB1
 
acaatcaatattatagccagatattttttcctttaaaaatatttaaaagaggggccagaaaagaaccagagagggaggccatgagacattattatcacta  22906200
                                              <---------AHL20(2)
                                              --------->AHL20(3)
                                              --------->AHL12(3)
                                              <---------AHL25(3)
                                              <---------AHL20(3)
                                              --------->AHL25(3)
                                              <---------AHL20(1)
                                              <---------AHL25(2)
                                              --------->AHL25(2)
                                              --------->AHL25(1)
                                              <---------AHL25(1)
                                            --------->AHL12(2)
                                          *TSS--------->AHL20(2)
                                         <---------AHL20(1)
                                         <---------AHL25(3)
                                         --------->AHL20(1)
                                         <---------AHL20(2)
                                         --------->AHL25(3)
                                         <---------AHL25(2)
                                         --------->AHL20(3)
                                         <---------AHL20(3)
                                         <---------AHL25(1)
                                         --------->AHL25(2)
                                        --------->AHL20(2)
                                        --------->YAB1
                                       <---------YAB1
                                      <---------AHL12(3)
                                      <---------AHL12(2)
                                      <---------AHL20(3)
                                     <---------AHL25(3)
                                     --------->YAB1
                                     -------->ATHB1
                                    <---------AHL20(2)
                                    --------->AHL20(2)
                                    <---------AHL12(1)
                                    --------->AHL20(3)
                                    --------->AHL12(1)
                                    <---------AHL25(1)
                                    <---------AHL20(3)
                                    --------->AHL25(2)
                                    --------->AHL25(3)
                                    --------->AHL25(1)
                                    <---------ATHB51
                                    <---------AHL25(2)
                                   --------->AHL12(2)
                                 --------->AHL20(2)
                                --------->AHL12(3)
                                <---------AHL20(2)
                       <---------DAG2<---------ICU4
                       <----------DOF2--------->AHL25(2)                           <<<<<<<<<TBF1
                 <---------DOF5.7(1)--------->ICU4                              <<<<<<<<<TBF1
                 <----------DOF2--------->AHL20(2)                           <<<<<<<<<TBF1
                <---------DOF5.7(1)<---------AHL12(2)                     <<<<<<<<<TBF1  <<<<<<<<<TBF1
               <---------DOF5.7(1)--------->AHL12(2)                   <<<<<<<<<TBF1  <<<<<<<<<TBF1
    <----------ID1    <---------ANAC58<---------AHL25(2)             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
>ZAT6   ------->GAMYB <---------ANAC58--------->AHL20(3)          <------------------------ANAC81
>YAB5  --------->MYB46(3)       --------->AHL25(1)             <------------------------ANAC81 -----
---GT1 <---------MYB52(2)       --------->AHL25(3)     <---------TOE1(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
 
gtcaaaaacaacaaaccctccttttgctttttcatataaattattatattttattttgcaggtttcttctcttcttcttcttcttcttcttcttcttcct  22906300
                                                                   --------->ANAC58
                                                                   --------->ANAC58
                                                                  --------->DAG2
                                                                 --------->DOF5.7(1)
                                                                 ---------->DOF2
                                                            <---------------AGL15
                                                            --------------->AGL15
                                    --------->ANAC58       ----------------->AGL3
                                  <---------DOF5.7(2)      ----------------->AG
                   --------->TOE2(3)--------->ANAC58       =========================================
              <---------YAB5      --------->MYB52(1)       ----------------->AGL2
         <----------DOF2       --------->At4g35610   --------->ARR11(2)
     <----------DOF2           <---------At4g35610   --------->ARR14(2)
   --------->At4g35610 --------->DAG2                <---------ARR14(2)
   <---------At4g35610---------->DOF2                <-----------ARR10            <---------AHL12(2)
->ZmHOX2a(1)--------->YAB1  ---------->DOF2         <---------CCA1(2)  ---------->DOF2            --
 
cttggctgctttctttcatcatccataaagtgaaagctaacgcatagagagagccatatcgtcccaaaaaaagcaaaagtccaaaaaaaaacaactccaa  22906400
                                                                                            --------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                     <----------DOF2                <----------DOF2                         --------
                    <---------DOF5.7(1)            <---------DOF5.7(1)                     <-------TEIL
                <-----------GT1                   <---------------AGL15               <-----------RAV1(2)
               --------->ZAT14                <----------DOF2                    --------->ZAT14
              <----------DOF2                <---------DOF5.7(1)        --------->TOE1(2)<---------MYB52(1)
==================================================================MADS_MADS      --------->ZAT18
------->KAN1 <---------DOF5.7(1)           ------>NtERF2       <-------TEIL      <---------ZAT18 ---
 
aacattctctcttagctctttactctttagtttctctctctctctctgcctttctctttgttgaagttcatggatgctacgaagtggactcaggtacgta  22906500
   --------->ARR11(3)
   <---------ARR11(3)
  <---------RVE1(1)
  --------->RVE1(1)
  --------->CCA1(1)
  --------->GLK1(1)
  <---------GLK1(1)
  <---------CCA1(1)                                                                                <
 <---------ARR11(3)                                                                                -
 --------->ARR11(3)                                                                                <
--->GT1                                                                                            -
->ANAC58             <---------MYB52(1)                                                           --
->ANAC58        <---------ARR11(3)                                             <-----------GT1    <-
--ANAC55(2)     --------->ARR14(2)      ----------->HVH21                     <-----------GT1     --
--ANAC46<----------DOF2--------->MYB52(2)    <---------DOF5.7(1)           <---------DOF5.7(1)    <-
->ANAC55(2)     --------->RVE1(2)     ----------->RAV1(2)                 <----------DOF2         --
------->DOF2   <---------CCA1(2)<---------GLK1(2)                        <---------DOF5.7(1)    ----
 
aaaagatatctctttgctatatctgtttgtttctagcttctccctgactcttacgctctctctctctctctctctctctttttatctctctactcacata  22906600
        --------->ALFIN1
       <-------MYC3
       ------->MYC3
   <-------TEIL
---------ARR11(3)
-------->AHL20(1)
---------AHL25(3)
-------->ARR11(3)                                           --------->KAN1
------->AHL20(2)                                           --------->ARR14(2)                  <----
--------AHL12(1)                                           <---------RVE1(2)                   -----
------->AHL12(1)                                           <---------ARR14(2)         <---------ANAC46
--------AHL12(3)     --------->YAB5              ----------->GT1           --------->GLK1(1) -------
------->AHL12(3)   ------->TEIL------->TEIL      <---------MYB46(3)       --------->ARR11(3) <------
----->AHL20(3)    <---------AtLEC2              <---------YAB5            <---------ARR11(3) -------
 
aatatatacatgtgtgtgtatgcatgtttatatgtatgtatgaaaccagtagtggttatacagatagtctatatagagatatcaatatgatgtgttttaa  22906700
<- Previous    Next ->

AGI:  At3g61850.1   
Description:  DAG1 (DOF AFFECTING GERMINATION 1); DNA binding / transcription factor. Identical to Dof zinc finger protein DOF3.7 (DOF3.7) [Arabidopsis Thaliana] (GB:Q43385;GB:Q8GYW3;GB:Q9SAF9); similar to DAG2 (DOF AFFECTING GERMINATION 2), DNA binding [Arabidopsis thaliana] (TAIR:AT2G46590.2); similar to Dof17 [Glycine max] (GB:ABI16018.1); contains InterPro domain Zinc finger, Dof-type; (InterPro:IPR003851)
Range:  from: 22906243    to: 22908533    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version