AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   <
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                            --------
                                                                                         <---------ANAC46
                                                                                         <---------ANAC58
                                                                                         <---------O2
                                                                                         <---------ANAC58
                                                                                         <---------TGA1a
                                                                                         --------->DEAR3(1)
                                                                                         --------->O2
                                                                                         --------->TGA1a
                                                                                        <------NtERF2
                                                                                        --------->ATERF1(1)
                                                                                       <---------RAP2.6(3)
                                                                            <---------MYB59---------
                                                                           --------->At4g35610    <-
      <---------At4g35610                                         <---------At4g35610  ------>NtERF2
------->DOF5.7(1)    <---------ANAC55(2)                          <---------ZAT2      <---------ATERF1(2)
------>DOF5.7(1)     --------->ANAC55(2)      <---------RVE1(2)   --------->ZAT2      --------->ATERF1(2)
------->DOF2     --------->AHL20(3)       <----------DOF2         --------->At4g35610 --------->DEAR3(1)
-->LBD16<---------ATHB12         --------->ZAT14             --------->ANAC46        <---------RAP2.6(2)
--HSFB2a(2)      <---------AHL20(3) <---------ALFIN1         --------->ANAC58    ==================bZIP_DOF
->HSFB2a(2)<---------WOX13(1)    <---------ZAT18             --------->ANAC58    <----------DOF2 <--
 
aaaagcctccgatgatggattaatatgtaatctctgtgaacaccgctttgattctggtgaagacaggccagctaaacgagctaactttgccgccgtgtcg  22546300
                                                                            <---------ETT(1)
                                                                            ----------->HVH21
                                                                           --------->DEAR3(2)
                                                                           =====================HOX2a_HOX2a
                                                                           ------>ZmHOX2a(2)
                                                                           =========================
                                                                          ======================HOX2a_HOX2a
                                                                          ==========================
                                                                          <------ZmHOX2a(2)
                                                                         --------->ARR11(2)
                                                                         --------->ARR14(2)
                                                                         <---------ARR11(2)
                                                                         <---------ARR14(2)
                                                                         <---------GATA12
                                                                         --------->GATA12
                                                                     ===========================HOX2a_HOX2a
                                                                     ------>ZmHOX2a(2)
                                                                    <------ZmHOX2a(2)
    --------->MYB52(1)                                              ============================HOX2a_HOX2a
   ----------->HVH21                                               <---------ARR11(2)
------>ZmHOX2a(2)                                                  --------->ARR11(2)
------ZmHOX2a(2)                                                   --------->ARR14(2)
------->GATA12                                                     <---------GATA12
--------ARR11(3)                                                   --------->GATA12 <---------CCA1(2)
--------GATA12                                              =====================HOX2a_HOX2a   <----
------->ARR11(3)                                            ================HOX2a_HOX2a     <-------
--------ARR11(2)      --------->ANAC46                      ===============HOX2a_HOX2a   ------>ZmHOX2a(1)
------->ARR14(2)    --------->REM1(1)                       ======================HOX2a_HOX2a <-----
->REM1(2)       <---------At4g35610                         <------ZmHOX2a(1)----------->RAV1(1)
>ALFIN1  --------->AGP1      --------->ZAT14       --------->KAN1  --------->ARR11(3)--------->ARR14(2)
--------ARR14(2)--------->At4g35610               <-------TEIL     <---------ARR11(3)--------->ARR11(2)
-------GLK1(1)--------->REM1(1)                  <-----------GT1   <---------ARR14(2)<---------ARR14(2)
 
agatccctaacagagctacagctacaagactctccagtctccattctccaatatacatccctaggacgacgatctggatccgacattatatcctccgctc  22546400
            <---------ZAT14
            --------->ZAT14
            --------->ABI4(2)
            <---------ZAT18
          --------->ATERF1(1)
          <------NtERF2
         <---------DEAR3(2)
         <---------ORA47(2)
         <---------MYB46(3)
         <---------DEAR4(2)
        --------->ALFIN1                 <------ZmHOX2a(2)
        <---------DREB2C(2)             --------->GATA12
        <---------DEAR3(1)              <---------GATA12
       <---------ABI4(1)                <---------ARR14(2)
     <---------DEAR3(1)                 <---------ARR11(2)
   <<<<<<<ZML2                          --------->ARR11(2)
<---------HSFC1(1)                      --------->RVE1(2)
--------->HSFC1(1)                      --------->ARR14(2)
<---------HSFB2a(2)                   <---------MYB46(3)                           --------->LBD16
------>ZmHOX2a(1)--------->ZAT14    <---------LBD16                                ------>NtERF2
--------->HSFB2a(2)               --------->ANAC58 --------->ATHB12               --------->DEAR3(1)
=======HOX2a_HOX2a        --------->DOF5.7(1)      --------->YAB5                <---------LBD16
=======HOX2a_HOX2a      ---------->DOF2<------NtERF2                            <---------ATERF1(1)
-----DOF5.7(1)   <---------ZAT14  <---------DEAR3(1)                 --------->WRKY45        <------
--At4g35610--------->ALFIN1       --------->ANAC58--------->ICU4     --------->WRKY38(1)  <---------
-----DOF2<---------ATERF1(1)     --------->SPL7(1)<---------YAB1   <----------DOF2--------->ANAC46
 
ttcctagaacggcggtgcagttcagagaaaagatggcacggcggatcagagacatgattcgaaaaccccgctttgactctggtctccgcctctctggtgg  22546500
                         <---------AtMYB61
                     ------->MYC2
                     ------->MYC3
                     <-------MYC3     --------->AHL20(1)
                     <-------MYC2     <---------AHL20(1)
                    --------->TGA1a   <---------AHL25(3)
                    --------->O2      --------->AHL20(3)
                    <---------O2      <---------AHL20(2)
                    <---------TGA1a   <---------AHL25(1)
                    =============MYC_MYB
                    <---------ANAC55(2)
                    =========================================bZIP_DOF
                    <---------ANAC46  --------->AHL25(2)                                       <----
                    --------->ANAC55(2)    --------->ATHB12                                    -----
            --------->LBD16          --------->AHL20(2)                                        -----
           <---------DEAR3(1)       <---------YAB1                                             <----
          --------->ATERF1(1)      --------->AHL20(3)                                          <----
          <------NtERF2 <--------P --------->AHL25(2)                                          -----
         ------>NtERF2 --------->REM1(2)  <-------TEIL                                         -----
        <---------ATERF1(2)        --------->AHL20(2)               <------ZmHOX2a(2)          -----
        --------->ATERF1(2)        <---------AHL20(3)              --------->ARR11(2)          <----
        --------->DEAR3(1)        <---------ICU4                   <---------ARR11(2)         <-----
        <---------DEAR3(1)        <--------HAHB4      --------->HSFB2a(2)                     <-----
       --------->ATERF1(1)<------MYB46(1) <---------YAB5           <---------GATA12         <-------
       <---------RAP2.6(2)<------MYB83<---------AHL20(3)           --------->GATA12         <-------
   ===========================MYC_MYB--------->YAB1   <---------HSFB2a(2)                   <-------
   <--------P<---------MYB52(1)  <---------YAB1    <---------DOF5.7(1)       ------->TEIL   --------
---ANAC46<------NtERF2--------->ALFIN1<---------AHL25(2)           --------->AGP1<---------GATA12
--RAV1(1)<---------ATERF1(1)     --------->ICU4   <----------DOF2  --------->RVE1(2)    --------->KAN1
 
agacgagttggccgccggtgttcacgtgtaggtctcattattatattcatgggctttttagaaacaaatagatccaaatggaccgatttgaaaatgcgta  22546600
      <----------DOF2                          <---------ICU4
-----ARR11(1)                            --------->WOX13(1)
---->RVE1(2)                            --------->MYB46(3)
---->ARR11(2)                  --------->TOE2(3) --------->ICU4       ------->PIF5
-----ARR11(2)             <---------WOX13(2)   <--------HAHB4         <-------PIF5
-------ARR10              --------->WOX13(2)   --------->YAB1        --------->At4g35610
---->ARR14(2)            --------->AHL12(2)   --------->ICU4         ----------->RAV1(2)
-->TEIL                  <---------AHL12(2)   <---------YAB1         <---------At4g35610
---->GLK1(2)            <---------AHL20(2)    <---------YAB5  <---------AHL20(2)
-----ARR14(2)           --------->AHL20(2)  <---------ICU4    <---------AHL25(1)
----CCA1(2)         ----------->GT1    ------>MYB83         <---------AHL12(2)
----ARR14(1)   --------->ANAC58<---------DOF5.7(1)<---------ICU4    ------->TEIL
--ANAC58       --------->ANAC58--------->TOE1(3) <---------YAB1   <---------ZAT18
--ANAC55(2)   --------->DOF5.7(1)      ------>MYB46(1)      --------->AHL12(2)
--ANAC58     --------->DOF5.7(1)<----------DOF2--------->YAB5--------->AHL20(2)   ------->TEIL  <---
->ANAC55(2)  ---------->DOF2<-----------GT1 --------->YAB1<---------RVE1(1)     *TSS           -----
 
tctatgggcctttgaaaaaagccatgttaaattacctttaccatccatcatcattatcgcgatatttaatgcacctgcaaaactgaaccctaagtgatca  22546700
                                                                                                   <
                       --------->ANAC46                                                       ------
                       --------->ANAC58                                                     <-------
                    <---------SPL7(1)                                                       --------
                  <---------------AtSPL3                                                    ========
               ------>NtERF2                                                                <-------
               <------NtERF2                                                                --------
              --------->RRTF1(2)                                                            ------>ZmHOX2a(2)
              --------->RAP2.3(2)                                                          <------ZmHOX2a(2)
              --------->RAP2.3(3)                              <---------ANAC58           <---------ARR14(2)
              --------->RAP2.6(2)                              <---------ANAC58           --------->ARR14(2)
              --------->DEAR3(1)                              <-----------------------TaNAC69(2)  ==
            <---------ATERF1(1)                          <---------ANAC58                 <---------ARR11(3)
            --------->At4g35610                      <---------MYB52(1)                   --------->GATA12
            --------->LBD16                          <-------GAMYB                        <---------GATA12
            ------>NtERF2                           --------->LBD16                      --------->GLK1(1)
           --------->DEAR3(1)                      <---------ANAC46                 ===============HOX2a_HOX2a
           <---------ALFIN1                       <---------LBD16                   <------ZmHOX2a(1)
           --------->ANAC46                     <---------ARR14(2)             ------>MYB46(1)======
         <---------ATERF1(1)                    <---------ARR11(2)      <---------ANAC58 <---------GLK1(1)
         ------>ZmHOX2a(1)                      --------->ARR11(2)      <---------ANAC58----------->ARR10
        <---------ALFIN1  --------->KAN1      <---------MYB46(3)   --------->KAN1   ==============HOX2a_HOX2a
     <---------ALFIN1  --------->ANAC58 ---------->DOF2  <---------ANAC46    --------->MYB46(3)   --
--------HVH21 --------->RRTF1(3)     --------->RVE1(2)   <---------ANAC58<---------SPL7(1)--------->ARR11(3)
---->WOX13(1)--------->RAP2.3(1)    <---------ARR14(1)<--------P  <-------TEIL ------>MYB83=========
 
gtcatgtccctcctccgccgcattgtacgaaattcgaccgtatcaaaggctgttccggttgcgaaggcgttcatgccttacccactaggaagagatcctt  22546800
                             --------->At4g35610
                         <-----------HVH21
                        --------->WOX13(1)
                     --------->ARR14(2)
                     <---------ARR11(2)
                     --------->ARR11(2)
                    --------->GLK1(1)
      ---------->DOF2<---------ARR14(2)
---------ALFIN1    <---------MYB52(1)
>ZmHOX2a(1)   --------->GATA12
--HSFB2a(1)   <---------ARR11(2)
->HSFB2a(1)   <---------GATA12
=====HOX2a_HOX2a  --------->LBD16                                  <-----------HVH21
--HSFC1(2)    --------->ARR11(2)                         <---------ZAT14         ------>ZmHOX2a(2)
->HSFC1(2)    <---------RVE1(2)              <------NtERF2--------->ANAC46    --------->ATHB12
=======================HOX2a_HOX2a          ------>NtERF2<---------ZAT18      --------->YAB1
=======================HOX2a_HOX2a         --------->DEAR3(1) <---------ZAT14--------->ICU4
---->ZmHOX2a(1) ------>ZmHOX2a(2)          --------->RAP2.6(2)--------->ZAT14<---------ATHB12
=====HOX2a_HOX2a<---------LBD16<----------DOF2           --------->ZAT14     <---------YAB5        -
 
cctcactcccaaagcttgatccggtatccatcagctatatcgatagccgcccaatttctctgcgctacagagtcagggcaatgatcgagatgtctaatct  22546900
                                                                                        <------NtERF2
                                                                                       ------>NtERF2
                                                                                     --------->RAP2.3(1)
                                                                                    <---------RAP2.3(1)
                                                                                    <---------ATERF1(1)
                                                                                   <---------DEAR3(1)
                                                                                  <---------YAB5
                                                                                --------->ARR14(2)
                                                                                <---------ARR11(2)
                                                                                <---------ARR14(2)
                                                                                --------->ARR11(2)
                                                                              --------->LBD16
                                                                             --------->ANAC55(2)
                                                                             <---------ANAC46
                                                                             <---------ANAC55(2)
                             <---------ANAC46                                <---------ANAC58
                    <------NtERF2                                         <---------ARR14(2)
            --------->ARR11(3)                 <---------ETT(2)           <---------ARR11(2)      <-
   <---------HSFB2a(1)  --------->At4g35610    --------->ETT(2)           --------->ARR14(2)<-------MYC3
   --------->HSFB2a(1)  <---------ZAT2 <---------KAN1                    <---------GLK1(1)  ------->MYC3
   <---------HSFC1(2)   <---------At4g35610    ----------->HVH21   --------->At4g35610--------->ANAC46
   --------->HSFC1(2)   --------->ZAT2 --------->GLK1(1)           <---------At4g35610--------->DEAR3(1)
-------->ANAC46  <---------LBD16       <---------GLK1(1)   --------->DEAR3(1)<---------ANAC58-------
 
cgacgaagcctcgaagctctcgcggctagctgtcttgaacggatttctagtcgacagagacaccgtcttcatctgcaattccgtaatcggcgccatgtgt  22547000
                                                                                            ========
                                                                                            --------
                                                                                          <---------YAB1
                                                                                   ------>ZmHOX2a(2)
                                                                                  <------ZmHOX2a(2)
                                                                                 <---------GATA12
                                                                                 --------->GATA12
                 ------>NtERF2                                               =============HOX2a_HOX2a
          <---------TOE2(1)                                                  ------>ZmHOX2a(1)   ---
          <---------TOE1(1)                       <---------KAN1            --------->TOE1(2)    <--
       <---------SPL7(1)              <----------DOF2                      ----------->RAV1(2)   ---
   --------->MYB52(1)<---------CCA1(2)<---------DAG2                 --------->ANAC58   --------->YAB1
---------ID1  --------->YAB5     <---------WOX13(2)                  --------->ANAC46   <---------ICU4
-->ALFIN1--------->SPL7(1)       --------->WOX13(2)                  --------->ANAC58  <---------YAB5
 
agcgccaaacggtacgacgatgccatctctctgttcaattactttttcaacgagtctcagactcttccaaacacgctctcctgcgatctcatcatcaaag  22547100
                                                                   --------->At4g35610
                                                                   <---------At4g35610
                                                               <---------REM1(1)
                  <---------ETT(2)                             --------->ALFIN1
                  --------->DEAR3(1)                         <---------ANAC46
                  <---------DEAR3(1)                         <---------ANAC58
               --------->O2                                  =======================================
               <---------TGA1a                               <---------TGA1a--------->ARR11(2)
               ===============================bZIP_DOF       <---------ANAC58 ------>ZmHOX2a(2)
           <-----------HVH21             <-----------TGA1    --------->TGA1a<---------ARR11(2)
=========================bZIP_DOF        <-----------HVH21  ------->TEIL--------->LBD16
-->DOF2--------------------->WRI1  <----------DOF2        <---------SPL7(1) --------->GATA12
------>ZAT18   <---------ANAC46    ====================================bZIP_DOF       <-------TEIL
-------ZAT14   --------->TGA1a   --------->At4g35610      ----------->HVH21 <---------GATA12
------>ZAT14   <---------O2      <---------At4g35610  ----------->HVH21<-----------RAV1(2)  --------
 
cacactgcgaccaaggtcacgtcgacgatgctcttgagctctaccgtcacattttgctcgacggacgtgtagctccagggatcgagacatacatgatact  22547200
<- Previous    Next ->

AGI:  At3g60957.1   
Description:  pseudogene of GPT
Range:  from: 22544758    to: 22546531    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g60960.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G28380.1); similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G28340.1); similar to ACT11D09.4 [Cucumis melo] (GB:AAS80150.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 22546681    to: 22549610    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version