AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    <---------AHL25(1)                                                                           <--
    <---------AHL25(2)                                                                           <--
    --------->AHL25(2)                                                                           ---
    --------->AHL20(2)                                                                           <--
    --------->AHL25(1)                                                                           ---
    --------->AHL12(1)                                                                           <--
    <---------AHL12(1)                                                                           ---
   <---------AHL12(2)                                                                           ----
   <---------AHL12(3)                                                                           <---
   --------->AHL12(2)                                                                           ----
   <---------AHL25(2)                                                                           ----
   --------->AHL25(2)                                                                           <---
   --------->AHL12(3)                                                                           <---
   --------->AHL25(3)                                                                           <---
   <---------AHL20(3)                                                                           ----
   --------->AHL20(3)                                                                           <---
  --------->AHL12(2)                   <---------AHL20(3)                                       <---
  --------->YAB1                       --------->AHL25(2)                                       ----
--------->AHL12(3)                     <---------AHL25(2)                                       ----
<---------AHL12(3)                     <---------AHL12(1)                                      -----
--------->AHL25(2)                    --------->AHL12(2)                                       <----
--------->AHL20(2)                    <---------AHL12(2)                                       -----
<---------AHL20(3)                   <---------AHL25(1)                                        -----
--------->AHL20(3)                   --------->AHL12(3)                                        <----
-------->YAB1                        --------->AHL20(3)                                        <----
-------->AHL20(2)                    <---------AHL25(2)                                        -----
-------WOX13(2)                      <---------AHL20(3)      <---------AHL12(3)                <----
------>WOX13(2)                      <---------AHL20(2)      --------->AHL20(2)                -----
-->TOE1(3)                           <---------AHL12(3)      --------->AHL12(3)                <----
-->TOE2(3)                          --------->AHL20(2)       <---------AHL20(3)               ------
--->GT1                          --------->YAB1              <---------AHL20(2)               <-----
->ANAC58                        <---------YAB1               --------->AHL20(3)               <-----
->ANAC58<-----------GT1  --------->KAN1--------->AHL20(3)   --------->AHL12(2)                ------
-->AtSPL3                <---------KAN1--------->AHL12(1)<---------CCA1(2)                    ------
-->AtSPL8                --------->AHL12(1)         ------->TEIL          --------->YAB5      <-----
---AtSPL3                <---------AHL12(1)         -------->P --------->YAB1            -----------
---AtSPL8   ------>ZmHOX2a(1)<---------AHL20(2) --------->RVE1(2) <-----------GT1   --------->AHL20(2)
aataaaaataatttcctcatcgcatcaaatatttgattataaaattttaaaaatcaacctgtatattaataactggatgattcaaaataaactagaaaat  22140300
------AHL25(1)                                                                                 <----
----->AHL25(3)                                                                                 <----
----->AHL25(1)                                                                                ------
---->AHL25(2)                                                                                 ------
-----AHL12(1)                                      --------->AHL25(1)                         ------
---->AHL12(1)                                      <---------AHL25(1)                         ------
---->AHL25(3)                                      --------->AHL12(3)                         <-----
-----AHL25(2)                                      --------->AHL20(2)                         ------
-----AHL20(2)                                      <---------AHL12(3)                         <-----
---->AHL12(3)                                      --------->AHL20(3)        --------->At4g35610----
-----AHL12(3)                                      <---------AHL20(2)     =============HOX2a_HOX2a
---->AHL25(1)                                      <---------AHL20(3)     <------ZmHOX2a(2)   <-----
-----AHL25(1)                                    <---------WOX13(2)      <---------GATA12     ------
--->AHL20(3)                                     --------->WOX13(2)      --------->RVE1(2)<---------ANAC58
----AHL20(3)                                   --------->AHL20(2)        --------->GATA12 <---------ANAC58
----AHL12(2)                                   <---------AHL20(2)       <---------At4g35610  -------
--->AHL12(2)                   ----------->GT1 --------->AHL25(1)       --------->At4g35610  <------
--->AHL25(2)             ---------->DOF2       <---------AHL25(1) --------->KAN1<------ZmHOX2a(1)
----AHL25(2)        ----------->GT1           --------->AHL25(3) <---------RVE1(2)       --------->At4g35610
>GT1    --------->AHL20(3) --------->DOF5.7(1)--------->AHL20(2)--------->ANAC55(2)      <---------At4g35610
tattttcttaaaaatttatagaatggtaaaaagatggttttaaaactcatttatttaaatactacttacatattcagatcagaggagattgtagcttacg  22140400
----bZIP60(1)                                                                                -------
--->bZIP60(1)                                                                                -------
----TGA2(1)                                                                                  -------
----->TGA2(2)                             --------->DOF5.7(1)      <---------YAB1            -------
----ANAC55(2)                 --------->DAG2                       <---------YAB5        -----------
--->ANAC46                   ---------->DOF2                 ------->TEIL               <---------ZAT18
-->SPL7(1)            ----------->GT1   ---------->DOF2     <---------ARR14(2)<------ZmHOX2a(1)
-----STF1     ---------->DOF2--------->DOF5.7(1) <-----------RAV1(2) <---------RVE1(2)--------->ANAC46
tcatatgttatataagtaaaagaaatggtagaaaaagtaagagaaaagaagaccaggggagaagaaccttgtgattgtggaggaagactaggccacacga  22140500
   --------->GATA12                                   --------->AHL20(2)       <----------DOF2
   --------->ARR11(3)                              --------->AHL20(2)     ---------->ID1
   <---------ARR11(1)                            <----------DOF2       <---------DOF5.7(1)
  <---------CCA1(2)                              <---------DAG2       <----------DOF2
-->ANAC46                                       <---------DOF5.7(1)   <---------DOF5.7(1)
-->ANAC58                       ------>ZmHOX2a(1)<---------DOF5.7(1)  <---------DAG2
-->ANAC58                <---------ANAC58   --------->At4g35610      <---------DOF5.7(1)         ---
-->ANAC55(1)             <---------ANAC58   <---------At4g35610     ------>ZmHOX2a(1)    --------->RVE1(2)
>RAV1(1)         <---------At4g35610    <-----------HVH21--------->WOX13(2)   <---------DOF5.7(1)<--
aattcaaatctttcaaattcagcaacttgcttctcctcacatttgtcagcccctttatataataaacgttcctctttttcgtcttttcaacatatcagaa  22140600
                                                  <---------RVE1(2)        <---------AHL20(3)
                                          <-----------ARR10                --------->AHL20(3)
                                          <---------ARR11(1)               --------->AHL20(1)
                                          <---------ARR11(3)               --------->AHL25(1)
                                          --------->RVE1(2)              --------->AHL12(2)
                                          --------->ARR11(2)             <---------AHL12(2)
                                          --------->ARR11(3)            --------->YAB1
                                          <---------ARR14(2)          <---------YAB1  <----------DOF2
                                          --------->ARR14(2)         --------->AHL12(2)
            --------->ZAT14              <---------CCA1(2)           --------->WOX13(2)   <---------
          --------->ANAC46             <---------ALFIN1           <---------DOF5.7(1)<---------DOF5.7(1)
        <-----------GT1             --------->ANAC46       <---------ALFIN1<---------AHL25(1)
     --------->WOX13(2)      <----------DOF2      <---------GLK1(2)  <---------WOX13(2)  --------->ATHB12
------>RVE1(2)------->TEIL  <---------DOF5.7(1) <---------YAB1    <----------DOF2   ------>ZmHOX2a(1)
-------ARR14(2)    <---------DOF5.7(1)--------->LBD16    ------>ZmHOX2a(1)--------->AHL25(3)
aatccctaaattcactgaaccctcttctctctctttctccccccatatcttctgattctcctccaactcctttattaataaattctcctctttcattgct  22140700
                                                  ------>MYB46(1)                    <---------ALFIN1
                                               ------>ZmHOX2a(2)                     --------->REM1(1)
                                             <---------GATA12             --------->HSFB2a(2) ------
                                             --------->GATA12         <---------GLK1(2)       <-----
        <---------ICU4                   <---------ANAC58            --------->HSFC1(2)    ---------
  *TSS ------>ZmHOX2a(1)                 <---------ANAC58            <---------HSFC1(2) --------->TOE2(3)
 ---------->ID1                       <---------GLK1(2)           ---------->DOF2  <-----------HVH21
---CBF--------->TOE2(3)          --------->ANAC46 -------->P     --------->ANAC46  ------>ZmHOX2a(1)
acttgtcttcctcatttccctactagtacttgtttcacacagtttcttgatccaaccaaaaccaatacacaaagcttctcaaactccttcacctcaaagc  22140800
         ----------->RAV1(2)    <---------ARR14(2)
         --------->At4g35610    --------->ARR14(2)
         <---------At4g35610    <---------GATA12
        <---------GATA12        --------->GATA12
   <----------DOF2              --------->ARR11(2)                      ------>ZmHOX2a(1)
  --------->TOE2(3)             <---------ARR11(2)                     --------->TOE2(3)
--->HSFC1(2)      <---------MYB52(1)            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
----HSFC1(2)   <---------YAB5   <---------RVE1(2)          <---------YAB5              <---------KAN1
->DOF2  --------->GATA12    <---------LBD16    ------>ZmHOX2a(1) <---------PCF2   --------->HSFB2a(2)
ttcttcctttacatctgaatcgttgagttaactcggatttgttctgcatcctctgtttctgaatcgtgggccatccttattttgtctcgaattcttcacc  22140900
              <-------TEIL                  <---------CCA1(2)
           <---------At4g35610           <------ZmHOX2a(2)                     --------->RVE1(2)
           --------->ZAT2               --------->ARR11(3)              ------>ZmHOX2a(2)
           <---------ZAT2               <---------ARR11(3)            <---------GATA12
           --------->At4g35610          --------->RVE1(2)             --------->ARR11(3)
        ---------->DOF2                 <---------GATA12              <---------RVE1(2)
       <------ZmHOX2a(2)            ---------->DOF2       <---------AHL25(2)   --------->GATA12
 <---------ANAC58           --------->At4g35610------>ZmHOX2a(2)      <---------ARR11(3)--------->ANAC46
 <---------ANAC58           --------->ZAT2 ----------->ARR10   <-----------HVH21    --------->ANAC46
 <---------ANAC46  <---------MYB46(3) --------->DOF5.7(1) --------->AHL25(2)   <---------GATA12
aattgcttcgatcaagctgcattggttaaccagttgccctaaagatcagatctttgagcaaaattttgtcactgatcttctaaatccaaaccagacacag  22141000
                           --------->TOE2(3)                                              ==========
                         <---------GATA12            <---------YAB5                <---------YAB5
                        <---------GLK1(1)       --------->YAB1             <---------MYB55(2)
                        --------->GLK1(1)      <---------YAB1              --------->MYB46(3)
                    <---------HSFC1(1)       <---------RVE1(1)             <---------KAN1 ==========
                    <---------HSFB2a(2)      <---------CCA1(1)     --------->KAN1 <-----------HVH21
                    --------->HSFB2a(2)     --------->ARR11(3)    <---------MYB52(1)     ------->TEIL
               --------->ATHB12             <---------RVE1(2)    ===================================MYC_MYB
               --------->KAN1               --------->AHL20(1)   <-------GAMYB ------->GAMYB     ---
            <---------At4g35610             <---------ARR11(3)  ----------->GT1=====================MYC_MYB
   -------->P  --------->YAB5           ---------->DOF2     --------->ANAC46--------->MYB52(1)   ---
caaaacaacctctgtagatgattcgagaaatctcaaacttacaaaaagatattataaacattcaagacagttattcgaacaaccgagtcatggacgtcgg  22141100
                                                                 <---------KAN1                 <---
                                                                <---------HSFC1(2)             -----
       ----------->GT1                                          --------->HSFC1(2)             -----
       --------->LBD16                        --------->ANAC58  --------->HSFB2a(1)           ------
      ------->GAMYB                           --------->ANAC46 ----------->ARR10             <------
     <---------LBD16                          --------->ANAC58<------NtERF2                 ------>ZmHOX2a(2)
    -------->P                            --------->ANAC58   --------->LBD16          --------->YAB5
    --------->MYB52(1)                    --------->ANAC58  <---------DEAR3(1)        --------->YAB1
  --------->MYB46(3)               --------->LBD16          <---------ANAC46       ================HOX2a_HOX2a
=============MYC_MYB              --------->DEAR3(1)       <---------LBD16         <------ZmHOX2a(1)
==============MYC_MYB            <---------LBD16         <---------RAP2.3(2)     --------->DOF5.7(1)
================================bZIP_DOF --------->DAG2  <---------RAP2.6(2)   ---------->DOF2<-----
------>ANAC58        <----------DOF2<------NtERF2       <---------At5g28300<------NtERF2  --------->ARR11(3)
------>ANAC58      --------->At4g35610  ---------->DOF2--------->MYB52(1) ------>NtERF2 <---------YAB1
aagaaacaaccggaaaaacatgagctttcgaagttcgccggagaaaagcaagcaagagttacggcggagtttctcggcgcagaaaaggatgatgatcccg  22141200
<- Previous    Next ->

AGI:  At3g59900.1   
Description:  (ARGOS); unknown protein. similar to ARL (ARGOS-LIKE) [Arabidopsis thaliana] (TAIR:AT2G44080.1)
Range:  from: 22140703    to: 22141441    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version