AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                      <---------AHL25(3)
                                     <---------AHL12(1)
                                     <---------AHL25(1)
                                     <---------AHL25(2)
                                     --------->AHL25(1)
                                     --------->AHL12(1)
                                     <---------AHL25(3)
          <---------TOE1(2)          --------->AHL25(2)
 ---------->DOF2                     --------->AHL20(3)
---------AHL25(3)                    <---------AHL20(3)
---------AHL20(2)                    <---------AHL20(2)
-------->AHL20(2)                    --------->AHL20(2)
-------AHL12(2)                      --------->AHL25(3)
-------WOX13(2)                      --------->AHL20(1)
------>WOX13(2)               --------->RVE1(2)
------AHL12(2)                --------->GLK1(2)
-----AHL20(3)                 <---------GATA12
---->AHL20(3)               --------->AHL12(1)
-----AHL20(2)               <---------AHL25(3)
---->AHL20(1)               <---------AHL12(1)
---->AHL25(1)              --------->AHL25(2)
-----AHL12(1)              --------->AHL12(3)
-----AHL20(1)              <---------AHL25(1)
---->AHL12(1)              --------->AHL20(2)
---->AHL25(3)         --------->AHL20(2)
-----AHL25(1)  <-------TEIL<---------AHL12(2)
---->AHL20(2)--------->GATA12--------->RVE1(1)
-----AHL25(3)<---------ARR11(2)      <---------AHL20(1)
-----AHL25(2)<---------RVE1(2)<---------ARR11(3)                                    <---------TOE2(3)
---->AHL25(2)<---------GLK1(2)--------->ARR11(3)                                    <---------TOE1(3)
--->AHL25(3) --------->ARR14(2)     --------->AHL12(2)                             ---------->DOF2
-->WOX13(2)  --------->ARR11(2)    --------->WOX13(2)                             <---------AHL20(2)
---WOX13(2)  <---------ARR14(2)    <---------WOX13(2)                 --------->ANAC55(2)      <----
->YAB1  <-------GAMYB <---------AHL20(2)                             <XXXXXXXXXXXXXXXXXXXXMIR846   <
 
aattaaaagctcgttggattcgtattaaaaaaaaatctaatttattgtttaccaaagttttctatgggcatttaagtatttgaatttaaagttatcgact  21179800
                                                                                                   -
                                                                                                   <
                                                                                                 <--
                                                                                                 ---
                                                                                               <----
                                                                                               -----
                        --------->AHL12(1)                                                    ------
       ----------->GT1  --------->KAN1                           <-----------GT1           ---------
   <---------ZAT14      <---------AHL12(1)              <-----------GT1        <---------ANAC58<----
------DOF2  --------->KAN1          --------->REM1(1)<---------AHL12(2)        <---------ANAC46-----
-----------GT1         <---------KAN4(2)          <---------AHL20(2)           <---------ANAC58-----
 
tttgactacattgtaatactcttggaaatattcaaaactacatctcttagtatataatataacaaaattcactagaccagttgtgtgtttagaaacataa  21179900
                                                                  <---------AHL12(2)
                                                                  --------->WOX13(2)
                                                                  <---------WOX13(2)
                                                                 --------->AHL20(2)
                                                                 <---------AHL20(2)
                                                                 <---------AHL20(3)
                                                                 --------->AHL25(1)       --------->AHL20(2)
                                                                <---------AHL25(1)        <---------AHL20(2)
                                                                --------->AHL25(3)        --------->AHL25(1)
                                                            <---------AHL20(2)            <---------AHL25(1)
                                                         -------->HAHB4         <---------YAB1
                                                         <---------AHL25(3)     <---------AHL12(2)
<---------AHL12(3)                                       <---------ICU4         --------->AHL12(2)
--------->AHL20(2)                                       --------->AHL12(1)    --------->AHL12(2)
<---------AHL20(2)                                       <---------AHL12(1)    --------->AHL20(3)
<---------AHL25(1)                                       <--------ATHB1        <---------AHL20(3)
--------->AHL25(2)                                      --------->ICU4         --------->AHL25(2)
<---------AHL25(3)                                      <---------YAB1 <---------TOE2(3)  --------->AHL12(3)
--------->AHL25(1)                                      <---------YAB5<-----------GT1     --------->YAB1
--------->AHL20(3)                                      <---------ATHB51--------->ANAC55(2)
<---------AHL20(3)                                     <---------AHL20(3)      <---------AHL25(2)
-------->AHL20(2)                                      --------->AHL25(2)     --------->AHL12(1)
---------AHL25(3)                                      --------->AHL20(3)     <---------AHL12(1)
-------WOX13(2)                                        --------->AHL12(2)    --------->ICU4  -------
------>WOX13(2)                                       --------->YAB1<---------AHL20(2)   <---------YAB5
-----AHL20(2)                                        <---------YAB1--------->WOX13(2)   <---------WOX13(2)
---->AHL20(3)                  --------->WOX13(1)  --------->YAB1--------->AHL20(3)   <---------YAB1
--->AHL20(2)                --------->RVE1(2) --------->ZAT18   <---------AHL20(2)    --------------
>YAB1                    <---------ANAC55(2)  --------->ZAT14   --------->AHL20(2) <-----------GT1
-----AHL20(3)            --------->ANAC55(2)  <---------ZAT18 --------->TOE2(3)<---------AHL12(2)
---->AHL25(1)           <-------TEIL     <---------KAN1<---------AHL25(2)    <---------YAB1<--------
---->AHL20(2)       <---------YAB1      --------->GLK1(2)--------->YAB5<---------TOE1(3)--------->WOX13(2)
 
aattaaaatactaaaaactatatatgatacatatcaatccaagaatatgtgaactcataataattcattaatttaacgtgattatttttctaattatatc  21180000
                          <---------AHL20(2)
                          --------->AHL12(3)
                          --------->AHL25(1)
                          --------->AHL25(3)
                          <---------AHL25(3)
                          <---------AHL12(3)
                          --------->AHL12(1)
                          --------->AHL25(2)
                          <---------AHL25(1)
                          --------->AHL20(2)
                          <---------AHL12(1)
                          <---------AHL25(2)
                         <---------AHL25(1)
                         <---------AHL25(2)
                         --------->AHL20(2)                                          --------->AHL20(2)
                         --------->AHL25(3)                                          --------->AHL25(1)
                         <---------AHL12(3)                                          <---------AHL25(3)
                         --------->AHL12(3)                                          <---------AHL20(2)
                         <---------AHL20(3)                                         --------->AHL20(2)
                         --------->AHL20(3)                                        <---------WOX13(2)
                         <---------AHL20(2)                                        --------->WOX13(2)
                        --------->AHL12(2)                                        ------>MYB83
                        <---------WOX13(2)                                   <-----------GT1
                        --------->WOX13(2)                                <---------AHL20(2)
                       <---------AHL12(2)                               <---------AHL12(2)
                      --------->AHL12(1)                                --------->AHL12(2)
                      --------->AHL25(2)                               <---------AHL20(3)
                      --------->AHL20(3)                               --------->AHL20(3)
                      --------->AHL25(1)                               --------->AHL20(2)
                      --------->AHL20(1)                               <---------AHL20(1)
                      <---------AHL25(1)                               --------->AHL25(2)
                      <---------AHL12(1)                               <---------AHL25(2)
                      <---------AHL25(3)                               <---------AHL12(1)
                      --------->AHL25(3)                               --------->AHL20(1)
                      <---------AHL25(2)                               <---------AHL25(3)
                      <---------AHL20(3)                               --------->AHL12(1)
                      <---------AHL20(1)                              --------->AHL25(3)
                      --------->AHL20(2)                              <---------AHL12(3)
                      <---------AHL20(2)                              --------->AHL25(1)
                    --------->AHL12(2)                                <---------AHL25(1)
                    <---------WOX13(2)                                --------->AHL12(3)
                <---------WOX13(2)                                    <---------AHL12(1)
                --------->WOX13(2)   ----------->GT1                  --------->AHL12(2)
         --------->AHL12(2)   --------->AHL20(2)                      --------->AHL12(1)
         <---------AHL25(2) <---------WOX13(2)                       --------->AHL12(1)
         --------->AHL20(3) --------->WOX13(2)                       <---------AHL12(1) <---------YAB5
  ----------->HVH21 --------->WOX13(2)                               <---------AHL25(2) --------->ICU4
-->RVE1(2)--------->ICU4<---------AHL12(2)                     <---------ANAC58   ------>MYB46(1)  <
->AGL15--------->ICU4--------->AHL25(3)                        <---------ANAC58 <---------MYB59-----
-AHL25(3)--------->AHL25(2)<---------AHL25(3)   <---------AHL12(2)   --------->AHL25(3)<---------TOE2(3)
 
aacatttgacataatttttagttaataaattaattcaatatagaaaaaaaaaaaaaactcatatgggcttgaaatattttataccaaattaatgatgtat  21180100
                    --------->ATHB12
                   <---------AHL25(1)
                   <---------AHL20(3)
                   --------->AHL20(1)
                   --------->AHL20(2)
                   <---------AHL20(2)
                   --------->AHL25(1)
                   --------->AHL25(2)
                   <---------YAB1
                   <---------AHL25(3)
                   <---------AHL25(2)
                  <---------AHL20(2)
                  --------->AHL20(2)
                  --------->AHL20(3)
                  <---------AHL12(3)
                  <---------AHL20(3)
                  <---------AHL25(1)
                  --------->AHL12(3)
                --------->WOX13(2)
                <---------WOX13(2)
              --------->AHL25(3)
             --------->AHL25(3)
             <---------AHL25(1)
             --------->AHL25(1)
             --------->AHL20(3)                                                     <---------YAB1--
             --------->AHL20(2)                                                    <---------AHL20(3)
             <---------AHL20(2)                                                    --------->AHL20(3)
         --------->YAB1                                         ----------->GT1    --------->AHL25(1)
        <---------YAB1                                         ----------->GT1     <---------AHL25(1)
        <---------YAB5                                       ---------->DOF2       <---------AHL25(2)
       <-----------GT1                                       --------->DOF5.7(1)   <---------AHL12(3)
      <-----------GT1                                       --------->DOF5.7(1)    <---------AHL20(2)
 <---------ANAC58 <---------AHL25(2)                    ------->GAMYB--------->RVE1(2)          <---
 <---------ANAC58 --------->AHL25(3)                   ----------->GT1        <---------YAB1  ------
-----------GT1<---------AHL20(2)            <---------AHL20(2)--------->DOF5.7(1)  --------->AHL20(2)
---->AHL25(3)<---------AHL25(2)   <---------KAN1    --------->MYB46(3) --------->YAB1 <------------CBF
 
tatttcgttttatcattttaattttattggaggtagtatatgtgtatttcattcaacaacgaaaaaaaggaaaatcatattttgattaaaattgaaatag  21180200
                                               <---------WOX13(2)
                                              ------>MYB46(1)
                                       <-----------TGA1
                                      --------->bZIP60(2)
                                     <------NtERF2
                                    XXXXXXXXXXXXXXXXXXXXX>MIR845B
                                    ------>NtERF2
                                    <---------ATERF1(1)
                                   <---------ARR14(2)
                                   <---------ARR11(2)
                                   --------->ARR14(2)
                        --------->MYB46(3)    ------>MYB83
                      ----------->RAV1(1)  *TSS--------->WOX13(2)
           ---------->DOF2         --------->ARR11(2)                          <----------DOF2
--------->GT1        --------->MYB46(3)<-----------HVH21             <----------DOF2
---ZmHOX2a(1)----------->GT1  --------->MYB52(1)                   <---------DOF5.7(1)<XXXXXXXXXXXXX
------------------>ANAC81------->GAMYB--------->ANAC46     --------->KAN1     <---------DOF5.7(1)
 
gaagaaaataagaagaaagtgacaacaacagacaaacggctccgtcaccaaattgacgagagagactctctcctttcaaactctttttcagtttcaactt  21180300
                  --------->AtMYB61
               --------->AtMYB61
            <---------ALFIN1                        <---------ARR11(3)                       <------NtERF2
            --------->ANAC58             <---------At5g28300                                <-------
            --------->ANAC58            <-----------GT1                               <---------AtLEC2
            --------->ANAC46         --------->GATA12      <<<<<<<<<TBF1   <---------ANAC58<--------
          <---------ALFIN1    <-------TEIL          --------->ARR11(3)     <---------ANAC58<--------
XXXXXXXMIR841  <---------ALFIN1--------->KAN1      <---------CCA1(2)       <---------ANAC46<--------
 
cttcgtctccctcccacaccacctctacatatatacattcgattcacagtctatatatcttcttcttctatgcctctggcgtttctctcgcatggcgggt  21180400
                          ------>MYB46(1)
                  --------->ANAC46
                 --------->LBD16
                 --------->HSFB2a(2)
                 ------>ZmHOX2a(1)
                 <---------HSFB2a(2)
              ------>ZmHOX2a(1)                                          <---------ZAT2
--MYB46(3)   <---------ALFIN1                              ------>ZmHOX2a(1)  ----------->HVH21
-ANAC58    ------>ZmHOX2a(1)                         --------->At4g35610------>ZmHOX2a(1)  ------>ZmHOX2a(1)
-ANAC46   <---------ALFIN1------>MYB83            <---------YAB5  <----------DOF2  <---------DOF5.7(1)
-ANAC58 ------>ZmHOX2a(1)<---------ALFIN1  ------>ZmHOX2a(1)     <---------DOF5.7(1) <---------DOF5.7(1)
 
ctatactcttcctcctcctcctcgaaacccactctgtcttcttctccttcttcatcatcttcctcgcgtcttttcctgctcgtgacccttcttcctctct  21180500
                                           ------>NtERF2
                                           --------->AtMYB61
                                          --------->DEAR3(1)                              <---------MYB46(3)
                                      <---------HSFB2a(2)                           --------->HSFB2a(2)
                                 <---------RAP2.6(2) --------->ANAC58               <---------HSFB2a(2)
                                 <---------ANAC46    --------->ANAC58               --------->ANAC46
                                 <---------ANAC58    --------->ANAC55(2)            --------->LBD16
                                 <---------ANAC58    <---------ANAC46              <---------LBD16
                                <------NtERF2        <---------ANAC55(2)           -----------------
                              <------NtERF2<---------ATERF1(1)                     --------------->AGL15
                              <---------DEAR3(1)  <---------MYB52(1)               <---------HSFB2a(2)
                              --------->ALFIN1    --------->ARR11(2)               --------->HSFB2a(2)
                              --------->ATERF1(1) --------->ARR14(2)           <---------KAN1
                            <---------ANAC58      <---------ARR11(2) <------ZmHOX2a(2)    --------->YAB5
                            <---------bZIP60(2)   <---------ARR14(2)<---------RVE1(2)--------->LBD16
                            <---------ANAC46     <-----------HVH21  --------->ARR11(3)    ----------
                            <---------ANAC58    --------->ANAC46    <---------ARR11(3)   <---------YAB5
     <---------DOF5.7(1)    <---------O2  --------->MYB46(3)  <---------WRKY38(1) <-----------------AGL1
  ----------->RAV1(2)      <-----------------------TaNAC69(2)--------->WRKY18(1)<---------ARR11(2) -
 
ctctcgcctgtttcgccttcgttctccaatggcgtggcggtctcgacgaccccgttacgcattggtcaatagatcatcacgagtttcccggaatggttac  21180600
                                                                                             -------
                                                                                           ---------
                                                                                          --------->ANAC55(2)
                                                                                          <---------HSFB2a(2)
                                                                                          ----------
                                                       --------->HSFB2a(2)                --------->ANAC46
                                                 <---------ARR11(3)                       --------->HSFB2a(2)
                                                 --------->ARR11(3)                       <---------
                                                 --------->GATA12                        <----------
                                                 <---------GATA12                        <----------
                                             <-------GAMYB<-----------HVH21              -----------
                                            <---------ANAC46                       ------>ZmHOX2a(1)
                                            <---------ANAC58             <---------DOF5.7(1) <------
                                            <---------ANAC58        <---------ARR11(2)   <----------
                                         <--------P    <---------HSFB2a(2)     <---------ARR11(2)
                                  <---------RVE1(2)------>ZmHOX2a(2)--------->ARR11(2)   <---------LBD16
>AGL1                            --------->KAN1  <---------RVE1(2)--------->KAN1  --------->TOE2(3)
->GT1  --------->MYB52(1)       <---------YAB1 --------->WRKY12   <---------MYB46(3)     -----------
------>GAMYB                 --------->GLK1(2) ----------->ARR10 <---------YAB5--------->ARR11(2)
 
aacccaagagaaacggtctctgcgtcgttcagtttctgattcgggttgcgttgatcttctaggtcagagtcgttccccttcgtttccttatttccggaat  21180700
<- Previous    Next ->

AGI:  At3g57200.1   
Description:  similar to ABI8/ELD1/KOB1 (KOBITO) [Arabidopsis thaliana] (TAIR:AT3G08550.1); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41451.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40716.1); similar to SDL-1 protein [Nicotiana plumbaginifolia] (GB:CAD21166.1); similar to IMP dehydrogenase/GMP reductase, putative [Medicago truncatula] (GB:ABD33320.1)
Range:  from: 21180244    to: 21183295    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version