AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                ----
                                                                                               -----
                                                                                              ------
                                                                                            <-------
                                                                                           ---------
                       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                                <--------
                   <---------At4g35610                                                     ------>ZmHOX2a(2)
                  <-----------RAV1(1)                                                    <---------ARR11(2)
               --------->GLK1(2)                                                         --------->GATA12
              <---------GLK1(2)                                                          <---------ARR14(2)
           --------->YAB1                       <---------ATHB12                         <---------GATA12
          <---------ATHB12                ------>MYB46(1)                <---------CCA1(2)<------ZmHOX2a(2)
          <---------YAB5                  ------>MYB83                   <---------KAN1  --------->RVE1(2)
        --------->WOX13(1)    --------->At4g35610                    --------->ANAC58    --------->ARR11(2)
      ------>ZmHOX2a(1)<------NtERF2      --------->AtLEC2           --------->ANAC58    --------->ARR14(2)
     --------->TOE2(3)------>NtERF2     --------->AtMYB61   --------->ZAT14             <------ZmHOX2a(1)
------ALFIN1 --------->KAN1   <---------At4g35610--------->YAB5  --------->KAN1<-----------RAV1(2)
 
cacttcatcctcaatcatattctggtgccaagtagcagccagaccatccaaatgaatagaaactacagacactcgcatctcttcaggtataggatccacc  20320400
                                                          <---------GATA12
                                                          --------->RVE1(2)
                                                         --------->GLK1(1)
                                                    --------->LBD16                                <
                                                    ----------->GT1                          <------
                                                  --------->TOE1(2)                       --------->ATHB12
 <---------AHL25(2)                             --------->ARR11(2)                        --------->YAB5
 --------->AHL25(2)          ------>ZmHOX2a(1)  <---------ARR11(2)                        <--------ATHB1
 <---------AHL20(2)         <---------ANAC55(2) <---------ARR14(2)                       <---------KAN1
 <---------AHL12(1)         --------->TOE1(3)   ------->TEIL                             <---------YAB1
 --------->AHL20(2)         --------->TOE2(3)   --------->GLK1(2)                        --------->ICU4
 --------->AHL12(1)    --------->YAB5           --------->ARR14(2)                       <---------YAB5
----->LBD16           --------->MYB46(3)        --------->GATA12                      ------------>ATHB5
---->DEAR3(1)      --------->MYB46(3)           <---------GATA12                     --------->LBD16
--->ANAC46   --------->TOE1(3)                 <---------GLK1(2)                   <---------LBD16 <
--ALFIN1     --------->TOE2(3)               <---------ATHB12             --------->TOE2(3) <-------
>MYB46(3)  -------->P-------->P           <---------ALFIN1--------->GLK1(2)    <-----------GT1     <
-ABI4(2)   ------->TEIL--------->AtMYB61 --------->MYB46(3)         --------->HSFB2a(2)  <---------ATHB12
 
gcaaaaaattgatcaaccttaaacaaccattccttaaccttctcaccactgaatctgggaaaatccaacttccctaaccttgttactcccgaatgattgt  20320500
                                  <---------At4g35610
                                  --------->At4g35610
                               <---------At4g35610
                               <-------GAMYB
                              <-----------RAV1(1)
                              --------->MYB52(2)
                              <---------MYB46(3)       <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                              <---------DEAR3(2)     ------->MYC3
                          --------->bZIP60(2)        ------->MYC2                      xxxxxxxxxxxxx
                          =============MYC_MYB       <-------PIF5             <---------GATA12
 ----------->HVH21        <---------O2               <-------MYC2             --------->ARR14(2)
---------ANAC58           <---------TGA1a            ------->PIF5             <---------GLK1(2)
---MYB46(3)               --------->O2               <-------MYC3             <---------ARR14(2)
---------ANAC46           --------->ANAC46   <---------KAN1                   --------->GATA12
--WOX13(1)                --------->TGA1a   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <-----------GT1
---------ANAC58  --------->ANAC55(2)    <---------At4g35610          <xxxxxxxxxxxxxxxxsmallRNA(i)
 
tagcgtgaccttgccttctcatgtaatccacgtctgttgctgaagcggatgaagcacgagctgtttgatgagtctcacccagatttgactgcttagatgg  20320600
                                            ------>ZmHOX2a(2)
                                          <---------GATA12
                                          <---------ARR14(2)
                                          --------->GATA12                   ------>ZmHOX2a(2)
           ------>ZmHOX2a(2)        <---------ANAC58                         =======================
         <---------ARR14(2)         <---------ANAC58             ------>ZmHOX2a(2)
         --------->ARR14(2)    --------->CCA1(2)               <---------ARR11(3)
         <---------ARR11(2)   --------->ARR14(2)  <---------GLK1(2)        <---------ARR11(3)
         <---------GATA12     <---------ARR14(2)  <---------ARR14(2)       --------->ARR14(2)
         --------->GATA12     <---------ARR11(3)  --------->ARR11(3)       <---------ARR14(2)
         --------->ARR11(2)   --------->ARR11(3)  <---------GATA12         --------->ARR11(3)
     <-------MYC3             <---------RVE1(2)   <---------RVE1(2)        --------->GATA12
     ------->MYC2             --------->ARR11(1)  --------->GATA12         <---------GATA12
     <-------MYC2    --------->ARR11(3)   --------->ARR14(2)   <---------RVE1(2)
     ------->MYC3    <---------ARR11(3)   <---------ARR11(3)   --------->GATA12          -----------
    <---------KAN1 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(l2)        --------->ARR11(3)       <-----------HVH21
xxxxxxxxxx>smallRNA(le3)   --------->LBD16--------->ARR11(3)   <---------GATA12      ----------->RAV1(2)
 
agacagcatgtggatcgcctcaaacatctccgagatatggcgctcgatcttcagattttgagcatcgatcttgctctcgatcttctccatctgtgactcc  20320700
                                                  --------->At4g35610
                                                  --------->ZAT2
                --------->ANAC58                  <---------ZAT2          --------->HSFB2a(2)
                --------->ANAC58               ------>ZmHOX2a(1)          <---------HSFB2a(2)     <-
     <---------At4g35610                       =======================HOX2a_HOX2a   <----------DOF2
     ------>ZmHOX2a(1)                         --------->LBD16            --------->LBD16        ---
 --------->ARR14(2)                    <---------MYB59                   *TSS      <---------DOF5.7(1)
 --------->ARR11(2)<---------DOF5.7(1)<---------At4g35610      <------ZmHOX2a(2)  <xxxxxxxxxxxxxxxxsmallRNA(s)
============HOX2a_HOX2a   <---------ETT(2)   ----------->RAV1(2)      --------->RVE1(2)    ---------
>HVH21  <---------At4g35610           --------->At4g35610      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)
 
atcgattcctctgcttctaacgccttctctcgacgagcttgagctaactcctgagctcgagtctcgatcaccatctccgagaaacgtctttgctctgata  20320800
                                               --------->YAB5
                                               <---------ICU4
                                          ------------>CBF
                                       ---------->DOF2
                             <---------ATHB12  --------->YAB1
                             ------------>CBF  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                            --------->RVE1(2) <---------ATHB12
                            --------->ANAC58  --------->ICU4
                         ------------>CBF--------->ANAC58
                        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                      ----------->RAV1(1)--------->ANAC58
                      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                   --------->AtMYB61  --------->AtMYB61               <---------ICU4
                   xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)               --------->YAB1
                --------->ANAC58      ------->GAMYB                  <---------YAB1
                --------->ANAC46    -------->P<---------YAB5         --------->ICU4
                --------->ANAC58   --------->WOX13(1)              <---------ICU4
       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
       --------->At5g28300  --------->ANAC58--------->WOX13(1)    --------->ICU4  --------->WOX13(2)
      ----------->GT1--------->ANAC46--------->MYB46(3)          --------->ANAC55(2)           <----
---------DOF2   <---------ALFIN1 <---------ATHB12           --------->YAB5    ----------->GT1  -----
------>TOE2(3)--------->AtMYB61--------->WOX13(1)    --------->MYB46(3)  <-----------GT1      ------
-->HVH21   <-----------GT1 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3) <---------ANAC55(2)          <-----
 
cctttaatacagtaaaaccacaccacaacacaatcaatcaaccaaagcaatcatcaacaactccgattacttattattacgatgtaaataacaaatgaaa  20320900
                                         --------->GLK1(2)
                                  --------->ANAC46
                                  --------->ANAC58
                                  --------->ANAC58
                                --------------------->WRI1
                             <-----------GT1
                          --------->ARR14(2)
                          <---------GATA12
                          <---------ARR11(2)
                          --------->ARR11(2)
                          <---------ARR14(2)
                          --------->GATA12
                       --------->HSFB2a(2)
                       <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
    <-------TEIL       <---------HSFB2a(2)                          <---------LBD16
  --------->YAB1      <---------LBD16 --------->ANAC58         --------->YAB5
<---------TOE1(2)  <---------GLK1(1)  --------->ANAC58      <------ZmHOX2a(1)                    xxx
-----GATA12        --------->GLK1(1)xxxxxxxxxxxxxxxx>smallRNA(i) ------->TEIL                  -----
---->GATA12        <---------KAN1 <xxxxxxxxxxxxxxxxsmallRNA(s)<---------KAN1           ---------->DOF2
--->GLK1(1)       xxxxxxxxxxxxxxxxx>smallRNA(se3)        <---------At4g35610xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
----GLK1(1)  --------->MYB52(1)--------->ANAC46      --------->AtLEC2     <---------KAN1      <-----
 
tccaatgttcataaaacaagggatttctggattcacctcgcaagaatcgacgttctatgcagaggatgaatctcggaatgttttcagagagaaaggaata  20321000
                                                      --------->AGP1
                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                                                <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                               --------->At4g35610
                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                           --------->WOX13(2)
                                          <---------AHL20(2)
                                          --------->ATHB12
                                         --------->AHL20(2)
                                         --------->ICU4
                                         --------->AHL25(3)          <---------WOX13(2)       ------
                                     <---------RVE1(2)<-----------ARR10                     <-------
                                 --------->ANAC55(2) <---------At4g35610                    --------
                      xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)            --------->WOX13(2)     <-------
                      --------->TOE1(2) <---------AHL12(2)       --------->ANAC55(1)--------->ORA47(1)
                      <---------ARR14(2)--------->AHL12(2) --------->ANAC58         <---------RAP2.6(3)
          --------->YAB1         <---------ANAC55(2) --------->At4g35610         <---------At4g35610
--------->MYB46(3)    --------->ARR14(2)<---------AHL12(3) --------->ANAC46      --------->At4g35610
xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)   <---------ARR11(3)<xxxxxxxxxxxxxxxxsmallRNA(i)--------->RAP2.6(2)
---->YAB1 --------->YAB5  --------->YAB5--------->AHL12(3) --------->ANAC58     --------->DEAR3(1)
----KAN1  --------->TOE2(3) ----------->HVH21<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) --------->DEAR3(1)
 
acaacaacttcaacgataacatgaaaatacgatgacacttgatatttattagcttcagctctacgcacacttaatttgaatcacagccgtccattgatct  20321100
               ------->MYC4
               ------->PIF5
               <-------PIF5
               <-------MYC2
               >>>>>>>>>>AtbZIP1
               ------->MYC2
               <-------MYC4
               ------->MYC3
              --------->O2
              <---------O2
              >>>>>>>>>>HY5
              --------->PIF3(3)
              <---------PIF3(3)
              <---------TGA1a                                         <---------AHL20(2)
              --------->TGA1a                                         --------->AHL25(1)
              --------->ANAC46                                        --------->AHL12(2)
         <---------RAP2.6(3)                                          <---------AHL12(3)
        --------->RAP2.6(2)                                           <---------AHL25(2)
        --------->DEAR3(1)           --------->RVE1(2)               <---------AHL12(1)
      <---------At4g35610           <---------CCA1(2)                --------->AHL12(1)
      --------->At4g35610     <---------ARR11(3)          <---------ANAC58
     --------->DEAR3(1)       --------->RVE1(2)           <---------ANAC58         <-----------GT1
  --------->YAB1    <---------DOF5.7(1)                   <---------ANAC46      <---------DOF5.7(1)
 <---------YAB5<-------MYC3   --------->ARR11(3)        ------>ZmHOX2a(1)    ---------->ID1        -
>ZmHOX2a(2) <---------ALFIN1  --------->ARR14(2)       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)  <--------
--RVE1(2)--------->ORA47(1)   <---------ARR14(2)--------->KAN1     <---------RVE1(2)  <----------DOF2
->ARR11(3) <---------WRKY12  --------->KAN1<---------ALFIN1      <---------YAB1<----------DOF2     <
--ARR11(3)<----------------PIF3(2)------>ZmHOX2a(1)   ----------->RAV1(2)   <-----------GT1---------
 
tctaatcacagccgtccacgtggccttactcaatatcctgtatcacacacattattctcctgcttgttctgattttttttttcttttttcttttctagat  20321200
                                                    <------MYB46(1)
                                    --------->DOF5.7(1)                                       <-----
                            <---------ANAC55(2)     <------MYB83                              ------
                            --------->ANAC55(2)     <---------DEAR3(2)                      --------
                            ----------->GT1    --------->DAG2                       --------->TOE2(2)
                            --------->ANAC46  --------->DOF5.7(1)                   --------->TOE1(2)
        <-----------GT1     --------->ANAC58  --------->DAG2                       <---------ZAT2
     --------->WOX13(2)     --------->ANAC58 ---------->DOF2                       ----------->RAV1(2)
-------->ARR11(3)           --------->ANAC55(1)--------->DOF5.7(1)         --------->MYB55(2) <-----
-HSFB2a(2)               ------>ZmHOX2a(1)   --------->DOF5.7(1)           <---------MYB46(3) ------
---------ARR11(3)  <---------DOF5.7(1)--------->DOF5.7(1)   <-----------RAV1(1)    --------->ZAT2
>HSFB2a(2)        <----------DOF2   ---------->DOF2--------->MYB59<---------ZAT18 ------->TEIL<-----
 
aagatttcaattcacaaatttctttttcctcacgtaaaaaaaagaagaaaaaggtcggtctacttgtggctcactcagtggttcgaacctgggtttagat  20321300
<- Previous    Next ->

AGI:  At3g54823.1   
Description:  transposable element gene. gypsy-like retrotransposon family, has a 4.4e-203 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor)
Range:  from: 20316278    to: 20320774    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version