AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                       ------>ZmHOX2a(2)
                                                       ============================HOX2a_HOX2a
                                                      --------->GLK1(1)
                                                      <---------GLK1(1)
                                                     --------->ARR11(2)
                                                     <---------ARR14(2)
                                                     --------->ARR14(2)
                                                     --------->ARR11(3)
                                                     <---------ARR11(3)
                                            --------->AHL25(2)
                                            <---------AHL12(2)
                                            <---------AHL25(2)
                                            <---------AHL20(3)
                                            --------->AHL20(1)
                                            --------->AHL20(3)
                                           --------->YAB1                    <---------ARR14(2)
                                           --------->AHL12(2)                <---------ARR11(3)
                                           <---------AHL12(2) --------->ANAC58
           --------->AHL20(2)            >>>>>>>>>>GT-3b      --------->ANAC58<---------KAN1
          <---------YAB1           --------->ANAC58  <---------ARR11(2)      --------->ARR11(3)
       <---------MYB52(1)          --------->ANAC58  --------->GATA12        <---------RVE1(2)
     ----------->GT1               --------->ANAC46  <---------AGP1          --------->ARR14(2)
-----ARR14(2)                    --------->ANAC46    <---------GATA12       <------ZmHOX2a(1)  <----
---->ARR14(2)                 <---------ZAT14       <---------CCA1(2)     <---------TOE1(3)   <-----
--->AHL12(1)<---------AHL20(2)--------->ZAT14     --------->ALFIN1        <---------TOE2(3)  <------
 
tttgcaatcggttattatatgtgtaagtgctactacacacgaagaaaaataatgtggatctcttgaagcaatcggctaaggatattgagcctagagaata  19303600
                                                                                    <-----------GT1
                                                                                 <---------AHL12(2)
                                                                                <---------AHL20(2)
                                                                                --------->AHL20(2)
                                                                                --------->AHL12(3)
                                                                                <---------AHL12(3)
                                                                                --------->AHL25(1)
                                                                                <---------AHL25(3)
                                                                                <---------AHL25(1)
                                                                                --------->ATHB51
                                                                                <---------AHL12(1)
                                                                                --------->AHL12(1)
                                                                                <---------ICU4
                                                                               --------->ICU4
                                  <---------ARR11(3)                           --------->AHL25(3)
                                --------->ANAC46                               <---------YAB1
                          <---------AHL12(1)                                   <---------YAB5
                          --------->AHL12(1)                                  <---------AHL25(2)
                         --------->AHL20(3)                                   <---------AHL12(2)
                         --------->AHL12(2)                                   --------->AHL12(2)
                         <---------AHL20(3)                                   <---------AHL20(3)
                         <---------AHL12(2)                                   --------->AHL20(3)
                         --------->AHL25(2)                                   --------->AHL12(3)
                         <---------AHL25(2)   <---------DOF5.7(1)            --------->YAB1
                        --------->AHL12(1)   <----------DOF2                 --------->YAB5
                    ----------->GT1          <---------DAG2                  <---------ICU4
--------->MYB52(1) <---------TOE2(3)     <---------RVE1(2)             <----------DOF2
-------GT1        --------->DAG2--------->ANAC58              <---------O2  <---------AHL20(2)     <
----KAN1         --------->MYB52(1)--------->KAN1             --------->O2  <---------YAB1--------->AHL20(3)
---KAN4(2)       ---------->DOF2--------->ANAC58           <----------ARF1--------->YAB1  --------->AHL20(2)
 
accagacggttttcaacacataaaggaaaattttcaagaaattcgatactttttttttatgggagacgagacaacttttataattatttacaaaaatata  19303700
                                                        <---------AHL20(1)
                                                        --------->AHL20(1)
                                                        --------->AHL20(2)
                                                        <---------AHL20(3)
                                                        --------->AHL20(3)
                                                        --------->AHL25(3)
                                                        <---------AHL25(2)
                                                       <---------AHL12(2)
                                                       --------->AHL12(2)
                                                      --------->WOX13(2)
                                                    <---------AHL25(1)
                                                    --------->AHL25(1)
                                                    --------->AHL20(2)
                                                    --------->AHL25(3)
                                                    --------->AHL12(1)
                                                    <---------AHL20(2)
                                                    --------->AHL12(3)
                                                    <---------AHL12(3)
                                                    <---------AHL25(3)
                                                    <---------YAB1
                                                    <---------AHL12(1)
                                                   <---------AHL25(3)
                                                   --------->AHL25(1)
                                                   --------->AHL25(3)
                                                   <---------AHL25(2)
                                                   <---------AHL25(1)
                                                   --------->AHL25(2)
                                                   <---------AHL20(3)
                                                   <---------AHL20(1)
                                                   --------->AHL20(3)
                                                   --------->AHL20(1)           ----------->GT1
                                                   --------->AHL20(2)       <---------WOX13(2)
                                                <---------AHL12(2)          --------->WOX13(2)
                                               <---------AHL25(3)           <---------AHL12(2)
                                               <---------AHL20(2)          --------->AHL20(2)
                                              --------->AHL20(2)           --------->AHL20(1)
                                              <---------AHL12(3)           <---------AHL25(3)
                                              --------->AHL25(3)           --------->AHL25(1)
                                              <---------AHL20(3)           <---------AHL25(2)
                                              --------->AHL25(1)           <---------AHL20(2)
                                              <---------AHL25(1)           --------->AHL12(1)
                                              --------->AHL20(3)           <---------AHL25(1)
                                              <---------AHL12(1)           <---------AHL12(3)
                                              --------->AHL12(3)          <---------AHL12(1)
                                              <---------AHL25(3)          --------->AHL12(1)
                                            <---------WOX13(2)            --------->AHL20(2)
                                            --------->WOX13(2)            <---------AHL20(2)
                                            <---------AHL12(2)            <---------AHL25(2)
                                           <---------AHL25(3)             --------->AHL25(3)
                                           --------->YAB1                 <---------AHL25(3)
                                           -------->HAHB4                 <---------AHL25(1)
                                           --------->YAB5               --------->AHL12(2)
                                           <--------ATHB1             --------->AHL20(3)
                                           <--------HAHB4             --------->AHL20(2)
                                          <---------AHL12(1)          <---------AHL25(1)
                                          <---------ATHB51            --------->AHL25(1)
                                          --------->ICU4<---------AHL25(1)--------->AHL25(1)
                                          --------->AHL12(1)          <---------AHL20(3)
                                          --------->AHL20(2)          <---------AHL20(2)
                                          <---------YAB1--------->AHL25(1)--------->AHL12(3)
                                        --------->YAB1<---------WOX13(2)--------->WOX13(2)      ----
                         --------->WOX13(2)<---------ICU4<---------AHL25(3)<---------AHL12(1)   ----
                       <---------AHL20(2) --------->AHL25(3)          --------->AHL12(3)   ---------
                       --------->AHL20(2)--------->AHL12(2)           <---------AHL12(3)   ---------
                  <-------GAMYB<---------DAG2 <---------AHL20(2)    <---------WOX13(2)     ---------
                 <------MYB46(1)       <---------AHL20(2)<---------AHL20(2)--------->AHL25(2)   ----
                 <------MYB83  <----------DOF2--------->AHL12(1)    --------->WOX13(2)     ---------
                 ----------->GT1      --------->AHL20(2)<---------AHL20(2)<---------AHL12(3)------>NtERF2
       <---------WOX13(1)<---------WOX13(2)--------->ATHB51        <---------WOX13(2)   --------->DOF5.7(1)
-------TEIL      <---------MYB46(3)<---------YAB1 --------->YAB1  <---------AHL20(2)  ---------->DOF2
 
gtttcatttgatttataagttggttataaattgactttatttttaataattaaatataatttaatgtgtttatttaaataatttagttataaagacgcca  19303800
                                            <---------AHL25(3)
                                           --------->AHL20(2)
                                           <---------AHL25(1)
                                           <---------AHL12(3)
                                         <---------AHL12(2)
                                         --------->AHL12(3)
                                         <---------AHL12(3)
                                        <---------AHL25(3)
                                       --------->AHL12(1)      <------NtERF2
                                       <---------AHL25(1)      ----------->HVH21
                                       --------->AHL25(3)     ------>NtERF2
                                       --------->AHL25(1)     --------->LBD16
                                       <---------AHL12(3)    <---------ANAC46
                                       <---------AHL12(1)   <---------LBD16
                                       --------->AHL20(2) <---------RAP2.6(2)
     ----------->GT1                   <---------AHL20(2) --------->ANAC46
----->AtLEC2                  ----------->GT1--------->KAN1<---------RAP2.3(1)
----->ANAC58                  <---------MYB46(3)          <---------RAP2.3(2)
>RAP2.6(2)                  <---------MYB52(1)    <----------DOF2              <---------YAB1
>ANAC46               --------->ZAT18  --------->AHL12(3)<---------LBD16 --------->ICU4
>ANAC58               <-------TEIL    --------->AHL12(2) <---------At5g28300<---------YAB1     -----
----->ANAC58      --------->DOF5.7(1) <---------AHL12(2)<-----------GT1  <---------YAB5  <----------
>ANAC58         ---------->DOF2      --------->YAB1  --------->WOX13(2)----------->GT1  --------->GATA12
 
tgcaattgttgttaaaaccaaaagatgcactgtttgttaaaaataaatatatgctttatttacggcgggacaagtagttattatgttatgggatttatag  19303900
                              --------->AHL12(3)
                              <---------AHL20(2)
                       <------MYB46(1)
                       ----------->GT1
                       <------MYB83
                   --------->WOX13(2)
              ----------->GT1 --------->AHL20(2)
            --------->DAG2    <---------AHL12(3)
            --------->DOF5.7(1)                              --------->HSFC1(2)
            <---------TOE2(3) <---------AHL20(3)          ---------->DOF2
           --------->DOF5.7(1)--------->AHL20(3)       ----------->TBP
          ---------->DOF2   ----------->TBP       --------->RVE1(2)                     ---------->ID1
  <---------MYB46(3)  --------->MYB59  <-----------HVH21--------->YAB1            --------->YAB5
---->WOX13(2)----------->GT1<---------YAB1       <---------KAN1      <---------ATHB12  *TSS
-TBP      --------->DOF5.7(1)--------->YAB1   --------->YAB5 <---------HSFC1(2)--------->ANAC46   <-
 
ttaagttgttgcaaaaaggttaaatttggttataaaaatagttgtcaaacgaatacctataaaaagcttccattcattttccaaaccattcgtctccatt  19304000
                                                                                    <-----------GT1
         ------>ZmHOX2a(1) <------ZmHOX2a(1)                               <---------ANAC58      <--
     <---------ARR14(2)  <---------TOE2(2)                     <------MYB83<---------ANAC46<--------
     --------->GATA12<---------YAB1                        --------->ATHB12<---------ANAC58<--------
     --------->ARR14(2)  <---------TOE1(2)    ----------->GT1  <------MYB46(1)     <-----------GT1
---------DOF2  ------>ZmHOX2a(1) ------>ZmHOX2a(1)   <----------ID1  ----------->HVH21 ------>ZmHOX2a(1)
 
tcttttcaaatccttctcctaattctcataggattcctagataatagaatgggaaaacgacaagattggtctgtgactgcttgtattttcctgttcttgt  19304100
                                                                            --------->ANAC58
                                                                            --------->ANAC58
                                                                   --------->TGA1a
                                                                   <---------O2
                                                                   --------->O2<---------ALFIN1
                                                                   =================================
                                                                   <---------TGA1a
                                                                   --------->At4g35610
                                                                   <---------ANAC55(2)
                                        --------->ANAC58           ----------->GT1
                                 ============================================bZIP_DOF
                                 <---------DOF5.7(1)               <---------At4g35610
                                 <----------DOF2                 <-----------RAV1(2)
                                <---------DAG2                  <---------MYB52(1)
                         ----------->RAV1(1)                   <-----------HVH21
  --------->bZIP60(1) --------->PCF2    --------->ANAC58  --------->MYB52(2)--------->ANAC46
--------DOF2         <------ZmHOX2a(1)  --------->ANAC46<--------P --------->ANAC55(2)             -
-ANAC58   --------->RVE1(2)     <---------DOF5.7(1)     =====================MYC_MYB             ---
-ANAC58  --------->GLK1(1) <---------ALFIN1           ----------->GT1----------->HVH21   <---------YAB1
 
ctttggcatcacaaatccattgtaggagccacataccttttccaagccctaagcgaggggttagttcgtcaggtgacacgagccacttcaatgtgattca  19304200
                                          <---------ARR14(2)
                                         --------->ZAT2
                                         <---------At4g35610
                                         <---------ZAT2
                                 --------->WOX13(2)
                              ------>ZmHOX2a(2)
                             <------ZmHOX2a(2)
                             --------->CCA1(2)                --------->O2
                            <---------ARR11(3)                --------->TGA1a
                            --------->RVE1(2)                 =================bZIP_DOF
                            <---------GATA12      --------->SPL7(1) <----------DOF2      <---------bZIP60(2)
                            <---------AGP1<---------ALFIN1    --------->bZIP60(1)     <---------ARR11(2)
                            --------->AGP1--------->ARR14(2)  <---------TGA1a        <-------GAMYB
                            --------->GATA12  --------->HSFB2a(2) --------->MYB52(2)<---------MYB46(3)
                            <-----------ARR10 --------->LBD16 ===============================MYC_MYB
                            --------->ARR11(3)<---------LBD16 <---------O2     --------->ZAT14
                        ================================================bZIP_DOF    --------->MYB55(2)
                        ---------->DOF2  --------->At4g35610 <---------TOE2(3) <---------ZAT14
     --------->ALFIN1<------ZmHOX2a(1)<---------At4g35610  ----------->TGA1--------->ZAT6<----------
 ---------->DOF2     ===============HOX2a_HOX2a--------->LBD16<---------bZIP60(1)  --------->ALFIN1
============bZIP_DOF ================HOX2a_HOX2a--------->LBD16 <---------MYB52(1)<---------MYB52(1)
-------->ANAC46     <----------ID1    --------->At4g35610  ----------->HVH21   --------->SPL7(1)----
------>ANAC46    ---------->DOF2 <---------WOX13(2)      ----------->RAV1(2) <---------SPL7(1) -----
 
acgcgaaagtgtgccttcgccaaaggacaaagatctaattcagcagctccccggacaaccttctgacgttactttcaaacagtacggtggttatgtggcc  19304300
                                                                                        <---------TOE2(2)
               <------MYB46(1)                                                     --------->MYB52(1)
               <------MYB83                                                       <---------WRKY12
             <--------P                                                           <---------WRKY38(1)
             <---------MYB55(1)                           --------->ZAT6    ------>ZmHOX2a(2)
            <---------MYB52(1)                         --------->ARR11(2) --------->ARR11(3)
           <---------SPL7(1)                          --------->At5g28300 --------->GATA12
        ------>MYB46(1)     <---------YAB1           ----------->GT1      <---------GATA12
-RAV1(1)------>MYB83--------------->AtSPL8--------->MYB46(3)       ------>ZmHOX2a(1)  ------->GAMYB
----->At5g28300<---------DEAR3(2)  <-------GAMYB     --------->LBD16      <---------RVE1(2)     ----
---->RAP2.6(2)<---------DEAR3(1)  <---------ANAC46 <---------LBD16 ================HOX2a_HOX2a  <---
 
gtaaacaaaccagccggtcggtttttgtactattatttcgttgaaaccatcaaacccggtaacactactcctcttgtgatctggttcaacggaggtatgt  19304400
                                                                <-----------GT1
                                                            --------->AHL20(2)
                                                            <---------AHL20(2)
                                                            <---------AHL20(3)
                                                          --------->AHL12(2)
                                                       <---------AHL25(2)
                                                       --------->AHL25(3)
                                                       <---------AHL25(3)
                                                       <---------AHL25(1)
                                                       <---------AHL20(2)
                                                       <---------AHL20(1)
                                                       --------->AHL25(2)
                                                       --------->AHL20(2)
                                                       --------->AHL25(1)
                                                       --------->AHL12(3)
                                                       <---------AHL20(3)
                                   <---------ANAC58<---------AHL20(2)
                                   <---------ANAC58--------->AHL12(3)
                                   <---------ANAC46<---------AHL12(1)
                                <---------MYB52(1) <---------AHL12(3)
                               <---------DOF5.7(1) --------->AHL12(1)
                               <----------DOF2     <---------AHL25(1)
                               <---------------AGL15   --------->AHL20(3)          <---------CCA1(2)
                              <-----------------AGL3 --------->AHL12(2)       <---------At4g35610
                     --------->HSFC1(1)           <---------AHL20(1)        <---------DEAR3(1)
                     <---------HSFB2a(2)          --------->AHL20(1)       <---------ZAT2     <-----
                     --------->HSFB2a(2)          --------->AHL25(3) <------ZmHOX2a(1)       <------NtERF2
--->TEIL    --------->KAN1    <---------DOF5.7(1)--------->AHL12(2) ----------->HVH21      ---------
----TEIL<---------KAN1  <---------GLK1(2)   ----------->GT1 --------->AHL20(3)--------->At4g35610
 
acatatagagaacatgtattccctctagaaactcctttacttggaactagttatatattttatttttttacaggaccgggctgctcatctctaggtgggg  19304500
<- Previous    Next ->

AGI:  At3g52000.1   
Description:  SCPL36 (serine carboxypeptidase-like 36); serine carboxypeptidase. Identical to Serine carboxypeptidase-like 36 precursor (SCPL36) [Arabidopsis Thaliana] (GB:Q9SV04); similar to SCPL38 (serine carboxypeptidase-like 38), serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT2G05850.1); similar to SCPL37 (serine carboxypeptidase-like 37), serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT3G52010.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40750.1); similar to putative serine carboxypeptidase [Pisum sativum] (GB:CAC19488.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40749.1); contains InterPro domain Pe
Range:  from: 19303988    to: 19305680    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version