AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                  <---------------AGL15
                                                                        <---------YAB1
                                                                        <---------AHL12(2)
                                                                       <---------AHL20(2)
                                                                       --------->AHL20(3)
                                                                       <---------AHL20(3)
                                                                       <---------AHL20(1)
               <---------AHL12(3)                                      --------->AHL12(3)
               --------->AHL12(3)                                      --------->AHL12(2)
              <---------AHL25(3)                                       <---------AHL25(2)
             --------->AHL25(1)                                        --------->AHL25(2)
             <---------AHL12(3)                                      --------->AHL25(3)
             --------->AHL20(2)                                      --------->AHL12(2)
             --------->AHL12(3)                                      <---------AHL12(3)
         --------->LBD16                                             <---------AHL20(2)
        --------->ANAC58                                             <---------AHL25(2)            <
        --------->LBD16                                              <---------YAB1       <------ZmHOX2a(1)
        --------->ANAC58                   --------->YAB1         <---------ARR11(3)     -----------
       <---------HSFB2a(2)             --------->YAB1             --------->ARR11(3)    <---------TOE1(3)
       --------->HSFB2a(2)           --------->RVE1(2)           --------->YAB1   <---------DOF5.7(1)
--------AHL25(3)               <---------TOE1(2)                <---------YAB5    <----------DOF2  <
--------AHL25(1)               <---------TOE2(3)                <---------YAB1    --------------->AGL15
------->AHL20(2)               <---------TOE2(2)                --------->ICU4   <---------DOF5.7(1)
--------AHL20(2)          <---------ARR11(3)               --------->TOE2(3)<-----------GT1   ------
------>AHL20(2)--------->AHL20(2)  <---------KAN1          --------->ANAC55(2)   <-----------------AGL3
------WOX13(2)--------->AHL20(1) <------ZmHOX2a(1)         <---------ANAC55(2)   --------------->AGL15
----->WOX13(2)<---------AHL20(1) --------->YAB1      <---------YAB1  --------->AHL25(1) <---------TOE2(3)
 
attaataggtcccgaaatatatatagaactatcttaggataatcaaaaatagtattctgataccgtaatgatattatttttactcctttttaaggaaaat  18974900
                                                                                --------->LBD16
                                                                               --------->ANAC46
                                                                               --------->HSFB2a(2)
                                                                               <---------HSFB2a(2)
                               <---------AHL12(1)                              --------->LBD16
                              <---------AHL12(1)                              <---------LBD16
                              <---------ICU4                                  <---------HSFB2a(2)
                              --------->AHL12(1)                    --------->DOF5.7(1)
                              --------->AHL12(3)                   --------->DOF5.7(1)    <---------
                             --------->AHL25(3)                    --------->DAG2      ---------->DOF2
      --------->KAN1        <---------AHL25(2)                    ---------->DOF2   <---------KAN1
--------->KAN1              <---------AHL20(2)              ----------->GT1   --------->HSFB2a(2)
---------RVE1(2)            <---------AHL20(3)            ---------->DOF2 --------->GLK1(1)
>GT1<-----------GT1         --------->AHL20(3)       --------->DOF5.7(1)  <---------KAN1 --------->DOF5.7(1)
---------YAB5               <---------AHL12(3)     --------->DOF5.7(1)    <---------GLK1(1)<------ZmHOX2a(1)
--->AHL12(2)                --------->AHL12(3)     ---------->DOF2--------->DOF5.7(1)  =============
 
tagttattcacattccaccatttatacatataaaaatttcatatatgtaagaaaaaaagaagaaagaaaaaaagcgggtttcccggaatgaaaaggacca  18975000
                             <------NtERF2
                             <---------At4g35610
                             --------->At4g35610
                      <---------O2     ------->GAMYB
                      --------->O2  --------->MYB52(1)
                      =========================MYC_MYB
                      <---------bZIP60(2)        <---------AHL12(2)
                      <---------ANAC58 --------->DEAR3(1)
                      --------->TGA1a --------->MYB46(3)
                      <---------ANAC58--------->DEAR3(2)  --------->YAB1
                      <---------TGA1a<---------At5g28300  --------->YAB5
             <---------AHL20(2)     <-----------GT1 --------->RVE1(2)
----------->GT1 <---------YAB1   --------->YAB1 --------->AHL12(2)
-ID1  --------->RVE1(2) --------->ALFIN1       --------->AHL20(2)                                ---
================================bZIP_DOF       <---------KAN1    --------->CCA1(2) ----------->GT1
 
agagagaaaaatccattttatgctaacgtggcagcataataaccgcccgattatatatcaacgataagagatgaattgttttcattttgtaacaacaaaa  18975100
                           --------->GATA12
                           <---------GATA12
                           --------->GLK1(2)
                           --------->ARR11(3)
                           <---------ARR14(2)
                           --------->ARR14(2)
                           <---------ARR11(3)
                           --------->RVE1(2)
                        --------------->AGL15
                        <---------------AGL15
                       ----------------->AGL1
                       <-----------------AGL1
                 <---------AHL20(2)
                 <---------AHL20(3)
              <---------AHL25(2)
              <---------AHL20(3)                                                           ---------
              --------->AHL25(3)                                                           <--------
              <---------AHL20(1)                                                         <---------AHL25(2)
              <---------AHL20(2)                                                         <---------AHL12(3)
              --------->AHL25(1)                                                         --------->AHL20(3)
              --------->AHL25(2)                                                         <---------AHL25(3)
              --------->AHL20(3)                                                         --------->AHL25(2)
              --------->AHL20(1)                                                         <---------AHL25(1)
              <---------AHL25(3)                                                         --------->AHL20(1)
             <---------AHL25(1)                                                          --------->AHL20(2)
             --------->AHL25(3)                                                          <---------AHL20(3)
             --------->AHL20(2)                                                          <---------AHL20(2)
             --------->YAB1------------------------>ANAC81                               --------->AHL25(1)
             <---------AHL20(2)                                                         <---------AHL25(3)
             <---------AHL12(3)                                                         <---------AHL25(1)
             <---------AHL25(3)                                                         --------->AHL25(3)
             --------->AHL25(1)                                                         --------->AHL20(2)
             --------->AHL12(3)                                                         <---------AHL25(2)
             --------->AHL12(1)                                                         --------->AHL12(3)
             <---------AHL12(1)----------->GT1                                          <---------AHL20(2)
           --------->AHL20(3) <---------HSFB2a(2)                                       --------->AHL25(1)
           --------->AHL25(2) --------->HSFB2a(2)  <---------MYB52(2)                   <---------AHL12(3)
           <---------AHL20(3)<---------LBD16    <----------ID1      --------->CCA1(2) <---------WOX13(2)
------>TOE1(2)<---------AHL25(1)            ---------->DOF2<---------ATHB12 <------ZmHOX2a(1)     <-
 
catgagagaaacaaaattatatttttgcaaaatctggaaaaacaaaacaaagaaacaaacaaatgaagaagagatgagaggagacagagaattaaattag  18975200
                                                <---------ANAC58
                                                <---------ANAC58
                                                <---------ANAC46
                                                <---------DEAR3(1)
                                               <------NtERF2
                                               --------->ATERF1(1)
                                              <---------RRTF1(1)
                                              ------>NtERF2
                                              <---------ERF1
                                              <---------RAP2.3(1)
                                             <---------DREB2C(2)
                                             <---------DEAR3(1)
                                             <---------RAP2.3(3)             --------->GATA12
                                             <---------RAP2.6(2)          <---------AHL20(3)
                                             <---------RAP2.3(2)          --------->AHL25(1)
                                             <---------RRTF1(2)           <---------AHL25(1)
                                      <-----------HVH21                   <---------AHL20(2)
                                    <---------TOE2(3)                     --------->AHL20(3)
                                    --------->MYB59                       --------->AHL20(2)
                                    --------->DOF5.7(1)                   <---------AHL12(3)
                                   <---------ICU4<-------GAMYB--------->ANAC58
   --------->At4g35610          --------->YAB1<---------ORA47(2)     <---------YAB1
--------->At4g35610   --------->CCA1(2)      <---------RRTF1(3)   --------->DOF5.7(1)
>WOX13(2)            --------->ARR11(3)      <---------ANAC46 --------->ANAC58             <<<<<<<<<TBF1
-WOX13(2)            <---------RVE1(2)--------->ARR11(3) <---------ZAT18  --------->AHL12(3)
-----ZmHOX2a(1)      <---------ARR11(3)     --------->RAP2.6(3) ---------->DOF2         <<<<<<<<<TBF1
 
aggagcagaagagagagagagagagatatagagattaataaggtcatggcggcgttgcagagcgcaagaaagatgatttaaatctctcttcttcttcttc  18975300
                                                --------->ANAC58
                                                --------->ANAC58
                                           --------->At1g77200         <---------GLK1(2)
      --------->RVE1(2)                    <---------ETT(1)        <---------At4g35610
      --------->ARR11(3)                  --------->DEAR3(2)<---------DAG2
      <---------ARR11(3)               <---------SPL7(1)   <---------ANAC58                  -------
     <---------CCA1(2)    --------->KAN1 --------->SPL7(1) <---------ANAC58     --------->DAG2
   --------->ANAC55(2)  *TSS        <------------------SPL14<----------DOF2    ---------->DOF2
 
cttcttacatatctctgtgtgtttcttaaatactctctctctcgtaccgacaaacaagttttgctttttcatcagagtctcaaaaagctattccaacttc  18975400
                                                       ------>ZmHOX2a(2)
                                                      <------ZmHOX2a(2)
                                                      --------->CCA1(2)
                                                     --------->ARR11(3)
                                                     --------->AGP1
                                                     <---------ARR11(3)
                                                     <---------AGP1
                                                     <---------ARR14(2)
                                                     --------->ARR14(2)                            <
                                                     <---------GATA12                             <-
                                                     --------->GATA12                             <-
                                                     --------->RVE1(2)                            <-
                                          <---------GLK1(1)                                       --
                                          --------->GLK1(1)                                       --
                               ---------->DOF2 ------>ZmHOX2a(1)                                  <-
                            <---------MYB59--------->ARR14(2)    ---------->DOF2                  --
                            --------->TOE1(3)  ==============HOX2a_HOX2a                         <--
  --------->ANAC46<---------KAN1          --------->KAN1   <---------ZAT6                    -------
-->TOE2(3)  --------->LBD16 --------->TOE2(3)  ===============HOX2a_HOX2a                    -------
 
aatacactacaaacccagagaatgaattcaacctaaaaaccctagaaatcctctaagatctagagtgagaaagttagagtgtatagaactacaaaacata  18975500
                                                                     <-------GAMYB
                                                                    --------->MYB111(2)
                                          <------MYB83        <---------MYB46(3)
                                          <------MYB46(1)     <------MYB83
                                          <---------ANAC58    <------MYB46(1)
 <----------DOF2                          <---------ANAC58   --------->ALFIN1
------>ZmHOX2a(2)                        <---------MYB46(3)  <---------DEAR3(1)
------ZmHOX2a(2)                         --------->MYB55(2)  <---------AtMYB61
--------ARR14(2)                      --------->MYB52(2) <---------ANAC46
----------ARR10                     <--------P        <---------ARR11(2)  <---------ANAC58
--------ARR11(3)                  <------MYB83       <-------GAMYB<-------GAMYB
------->ARR14(2)                  <------MYB46(1)  <---------ANAC46 --------->MYB55(2)  <------NtERF2
------->ARR11(3)                  <---------MYB46(3)<---------MYB46(3)    <---------ANAC58  <-------
--------GATA12                --------->ATHB12   <---------MYB46(3)<--------P          --------->LBD16
------->GATA12               <---------YAB1     --------->ALFIN1 <---------MYB46(3)   <---------ANAC58
----ZmHOX2a(1)             <---------ANAC58     <---------AtMYB61--------->MYB55(2)   <---------ANAC58
-->TOE2(2)                 <---------ANAC58  <---------MYB46(3) <---------AtMYB61    <---------LBD16
-->TOE1(2)        ---------->ID1<---------WOX13(1) <---------AtMYB61<---------MYB46(3)<---------ANAC46
 
ggatctttggttttgggttttgttccattttcttgattggttagtgggtgagtggtggttatgggtggtggttgttgtcttggtgaatggcggggttttt  18975600
                          --------->ALFIN1                                    ----------->RAV1(2)
                       <---------ANAC46                                      ------>NtERF2
                       <---------DEAR3(1)                                    --------->LBD16
                      <------NtERF2                                         --------->DEAR3(1)
                      --------->ATERF1(1)            <---------LBD16        <---------ALFIN1
                    --------->ALFIN1              ===============================HOX2a_HOX2a
                    <---------DEAR3(1)            <------ZmHOX2a(2)       ------>ZmHOX2a(1)
                   --------->ATERF1(1)            ============================HOX2a_HOX2a
                   <------ZmHOX2a(1)             --------->ARR11(3)       <---------ATERF1(1)
                 --------->ALFIN1         ------->GAMYB--------->LBD16   <---------ALFIN1
                <------ZmHOX2a(1)        --------->MYB46(3)        --------->ARR11(2)
           <---------ANAC46             --------->ANAC58           <---------GATA12
         <---------MYB46(3)             --------->ANAC58    ==============================RAV
         --------->MYB55(2)      ----------->GT1 --------->RVE1(2) --------->ARR14(2)           <---
        <---------DEAR3(1)<---------DEAR3(1)     --------->GATA12 --------->KAN1           <--------
        <---------AtMYB61 <---------AtMYB61      <---------GATA12 --------->GLK1(1)        <--------
        --------->ALFIN1 <------NtERF2--------->MYB46(3)    ----------->RAV1(1)           <---------HSFC1(2)
     <---------DEAR3(1)--------->ALFIN1------->GAMYB--------->MYB52(1) ------>ZmHOX2a(1)  --------->HSFC1(2)
--DOF5.7(1)--------->ALFIN1  --------->ALFIN1    <---------ARR11(3)<---------ARR14(2)--------->YAB1
 
ctcgctagacggtggtggaggaggaggcggaggtggaggtaacaaccaagaagatcaccggagcaacacaaatcctcctccgcctgtatcagaagcttgg  18975700
                            --------->ANAC58
                          XXXXXXXXXXXXXXXXXXXX>MIR2112-5P
                      --------->ANAC58
                      --------->ANAC58
                      --------->ANAC46                  <---------DOF5.7(1)
                    ---------->DOF2                 --------->ANAC58
                    <---------DOF5.7(2)             --------->ANAC58
                   --------->ARR11(2)         --------->ANAC46
                  --------->DOF5.7(2)         --------->ANAC58
                 --------->TOE2(3)            --------->ANAC58
                 --------->TOE1(3)         --------->ARR11(2)
               <---------TOE2(3)          --------->DOF5.7(2)
               <---------TOE1(3)         --------->TOE2(3)            --------->ANAC46
------RVE1(2) --------->MYB52(1)         --------->TOE1(3)------>ZmHOX2a(1) <----------DOF2
-ANAC58    --------->TOE1(3)--------->ANAC58<---------DOF5.7(2) <-----------HVH21
-ANAC58    --------->TOE2(3)--------->ANAC46---------->DOF2     --------->TOE2(3)<------ZmHOX2a(1)
 
ctctggtatagaaaccctaacgttaacgcaaacgcaaacacaaacgttaacgcaaacgctccttcttcgtcaaacgctgctttaggaacacttgagttat  18975800
<- Previous    Next ->

AGI:  At3g51060.1   
Description:  STY1 (STYLISH 1). similar to SHI (SHORT INTERNODES), transcription factor [Arabidopsis thaliana] (TAIR:AT5G66350.1); similar to hypothetical protein [Thellungiella halophila] (GB:ABB45842.1); contains InterPro domain Zinc finger, Lateral Root Primordium type 1 (InterPro:IPR006510); contains InterPro domain Protein of unknown function DUF702 (InterPro:IPR007818)
Range:  from: 18975325    to: 18977385    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version