AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          --------->YAB1
                --------->ATHB12                       --------->YAB1     <---------ICU4
               <---------YAB1                         <---------YAB5     <---------ATHB12
           --------->GATA12                      --------->ANAC55(1)     <---------YAB5
           <---------GATA12                      --------->ANAC58      --------->YAB1
           --------->ARR11(3)                    --------->ANAC58    <---------YAB1
           <---------ARR11(3)                    --------->ANAC46   --------->TOE2(3)              -
  <---------ALFIN1                              --------->LBD16    <--------HAHB4                  -
  --------->ANAC58                              <---------LBD16    --------->YAB1                  -
  --------->DEAR3(1)        --------->ATHB12--------->RVE1(2)      --------->YAB5                  -
  --------->ANAC58  ----------->GT1         <---------GATA12      <---------YAB1                   <
-->DOF5.7(1)   <---------YAB5               --------->ARR14(2)    <---------YAB5             -------
->DOF2    <---------CCA1(2) --------->YAB5  --------->GATA12  <----------DOF2                <------
 
ctgcaacgcctctaaatcttcattggtaaaacgattagactcgtctaaatccacggaatcatcttctttatcattaatcatcttcatacttcagaaaaaa  18113700
                             <--------ATHB1                                                       --
         --------->ZAT6      --------->YAB1                                                      <--
-------->ANAC46              --------->ATHB12                                                    <--
-------->ANAC55(2)          <---------YAB1                                                --------->HSFB2a(2)
-------->ANAC58             <---------ATHB12               <------NtERF2                  <---------HSFB2a(2)
-------->ANAC58 --------->ANAC58                          ------>NtERF2                --------->GLK1(2)
---------ANAC55(2)          --------->ICU4               --------->DEAR3(1)          --------->KAN1
-->AHL12(1)     --------->ANAC58                      <---------RVE1(2)         --------->At4g35610
---AHL12(1)     --------->ANAC46                    ----------->ARR10           <---------At4g35610
 
tcacgaaatacaacactacaagcatgggacaatgatggagattacttacagagattagagacgccgataatgtagattagaacagcagagattccagtag  18113800
                                                                       =============================
                                                                    --------->HSFB2a(2)          <--
                             <-------TEIL                           <---------LBD16             ----
                    <-------TEIL                                --------->GLK1(1)              *TSS-
                  --------->GATA12                         <---------ANAC46                   <-----
                  <---------GATA12                        <-------TEIL <------ZmHOX2a(1)      ------
            <---------KAN1  <----------DOF2            <---------At4g35610       ----------->GT1<---
       --------->YAB1    <---------ARR11(3)            --------->At4g35610 --------->DOF5.7(1)------
     <---------WOX13(2)  --------->ARR11(3)      --------->HSFC1(2) <---------HSFB2a(2)       <-----
-------->DOF2    <---------At4g35610             <---------HSFC1(2) <-----------RAV1(2)    <--------
-------WRKY45--------->RVE1(2)          --------->LBD16<---------ZAT2 --------->LBD16   --------->GLK1(2)
-------WRKY38(1) --------->At4g35610--------->ARR11(2) --------->ZAT2--------->LBD16  --------->KAN1
 
tcaaagctaataagaatatcagatgcaagagcttcatcgattccccagtagaagcttcagcttcgtgatttccaggagaagacgatgtgaaattctcgat  18113900
       ---------->DOF2
===HOX2a_HOX2a           <------ZmHOX2a(2)
--------DOF2            --------->GATA12
-->ZmHOX2a(2)           --------->RVE1(2)
----------->CBF         <---------GATA12
----GATA12              <-----------ARR10
--->GATA12         <---------ARR14(2)
------DOF5.7(1)    --------->ARR14(2)                                                      <--------
--->ARR11(3)--------->RVE1(2)                                --------->KAN1   <---------RAP2.6(2)
----ARR11(3)<---------ARR11(2)           <---------YAB1     <---------YAB1   --------->RAP2.6(3) <--
-HSFB2a(2)  --------->ARR11(2)     <---------KAN1           <---------YAB5 --------->DOF5.7(1)   <--
 
ctttcaattcaaaagtatccaagttccgatctaagcgagtgagtatgaaaacagcatgtagttctcattctgaagcttaagacggcttacagttctttca  18114000
                                         <---------------------WRI1
                                       --------->ANAC58
                                       --------->ANAC58                                  -----------
                                      --------->SPL7(1)                            --------->ANAC55(2)
                                    <---------SPL7(1)                              --------->ANAC46
                                   <---------MYB52(2)                             <---------LBD16
                                  --------->At4g35610                           ----------->HVH21
           <---------ANAC46       <---------At4g35610                        <---------GATA12
           <---------ANAC58       <------NtERF2                      --------->ANAC58 --------->ARR11(2)
--DOF2    ------>NtERF2      --------->ANAC46            ----------->GT1  <------NtERF2--------->SPL7(1)
-------DAG2<---------ANAC58  --------->ANAC58       >>>>>>>ZML2      --------->ANAC58 <---------ARR11(2)
--------DOF2                 --------->ANAC58  --------->KAN1      --------->MYB52(1) --------->MYB52(1)
 
ctttataaaacgctgcgtagataacttaagacaagccagcgaacgccgaaatgttctagtgagtaacatgaaacggcatcgatttgacggaacggtattt  18114100
                       <-----------GT1
                     ----------->TBP
              <-------MYC3
              <-------MYC2
              ------->MYC3
              <-------PIF5
              ------->MYC2
              ------->PIF5
              <-------MYC4
              ------->MYC4
             --------->TGA1a
             --------->bZIP60(2)
             <---------O2
             --------->O2                                                           --------->KAN1
             --------->PIF3(3)                                             <---------At4g35610
             <---------TGA1a                                          --------->RVE1(1)
             <---------PIF3(3)                                       --------->GLK1(2)
             <---------bZIP60(2)                                     --------->ARR11(3)
             <<<<<<<<<<HY5                                           --------->RVE1(2)
             >>>>>>>>>>HY5  <---------DOF5.7(1)                      <---------ARR11(3)
            <<<<<<<<<<AtbZIP1   <------------CBF                   --------->AHL12(1)
         <-----------------PIF3(1)                 --------->TOE2(3)--------->RVE1(1)
>GT1     <----------------PIF3(2)   *TSS           --------->TOE1(3)--------->CCA1(1)         ------
 
caaatgagaactggccacgtggctataaaccccttcattgttcatcttcaaaaaccctaacatttctgaaaaaatctctgcttcttcaaattccatcaaa  18114200
                                                                                         ===========
                                                                                         ------>ZmHOX2a(2)
                                                                                        ============
                                                                                        <------ZmHOX2a(2)
                                                                                       --------->ARR11(3)
                                                                                       <---------ARR11(3)
                                                                                       --------->RVE1(2)
                                                                                       --------->GATA12
                                                                                       <---------ARR11(2)
                                                                                       --------->ARR11(2)
                                                                    --------->ALFIN1   <---------GATA12
                                                                  --------->ALFIN1     <---------ARR14(2)
                        --------->YAB1                            <-----------RAV1(1)  --------->ARR14(2)
        --------->DAG2  --------->YAB5                    <-------GAMYB               <---------At4g35610
       ---------->DOF2 --------->ICU4                    <---------MYB46(3)           <---------GLK1(1)
--------->At4g35610    <---------ATHB12 <---------DAG2  <---------ANAC46              --------->At4g35610
--------->ZAT2 ---------->DOF2          <----------DOF2 <---------DEAR3(1)      <---------ANAC58   -
---->DOF2  --------->TOE1(3)    ----------->GT1         <---------RAP2.6(2)     <---------ANAC58<---
 
agcagcttgataaagcttaaaagcccatgatgaaatggtgaaactttttgatttcaatggcggttttaagtgtgggtttcttcgcttgcagatcccattt  18114300
                                         ----------->RAV1(1)
                                        --------->ANAC58
                                        --------->ANAC58
                             ----------->GT1
                            <---------TOE1(2)
                        --------->HSFB2a(2)
                        <---------HSFC1(1)
               <-----------GT1    --------->MYB46(3)                                             ---
======HOX2a_HOX2a       <---------HSFB2a(2)                                                 <-------
======HOX2a_HOX2a       --------->HSFC1(1)  ----------->GT1--------->KAN1                  <--------
----->ZmHOX2a(1)<---------At5g28300     --------->ANAC46  <---------AHL20(2)              <---------DOF5.7(1)
--------GT1  <----------DOF2<---------TOE2(2)   <---------YAB1                        <<<<<<<<<TBF1
 
tcctgttcttcccctgttttactgtttctcgaaggtaacaactacgacagtataattctatgtaattcgttctcatatacttaaaattcttcttcttttt  18114400
                                                                                       <---------YAB1
                                                                                     --------->YAB1
                                                                                     <---------ICU4
                                                                                    <---------YAB5
                                           <---------At4g35610                      --------->ICU4
                                           <---------ZAT2                           <---------YAB1
                                           --------->ZAT2                         --------->YAB1
                                           --------->At4g35610                   <---------YAB1
                                         <---------RAP2.6(2)                   --------->YAB1
                           <---------At4g35610                                 <---------ICU4
               <---------ANAC58 <---------ZAT14                               <---------YAB5
               <---------ANAC58 --------->ZAT14                               --------->ICU4
<---------AHL20(2)         --------->At4g35610                              --------->YAB1
------>TOE2(3)--------->At4g35610       <---------At4g35610        ---------->DOF2<---------ICU4
--DOF5.7(1)   <---------At4g35610<---------ALFIN1               --------->YAB5<---------YAB1
--DOF2 ---------->ID1   <-------TEIL<-----------RAV1(1)        ----------->HVH21 <---------YAB5    <
 
tcttaaatttgttgtttagcttacaggttcagctcaacactgttgctgctgcaatggagactgtggatgacaaagacagtgatcatcatcatgacaaggg  18114500
                                          <---------WOX13(2)
                                          --------->WOX13(2)
                                        --------->AHL25(1)
                                        --------->AHL20(2)
                                        <---------AHL25(3)
                                        <---------AHL25(1)
                                        <---------AHL20(3)
                                       --------->AHL25(3)
                                       --------->AHL20(2)                <-----------GT1<---------WOX13(1)
                   <----------DOF2<---------WOX13(1)                 ------>ZmHOX2a(1)--------->ATHB12
           <---------KAN1    <---------KAN1<---------WOX13(1)  --------->KAN1      --------->ANAC55(2)
    --------->DOF5.7(1)     ------->TEIL<---------AHL20(2) <----------DOF2<-----------GT1
---------YAB1      --------->TOE2(3) <---------GATA12     <---------DOF5.7(1)<----------DOF2
 
ttctaataagacgagtaagttactttaaacgaatttgatggatttaattgaaaactgtgcttctttttattcctatttatctttttaagtgattgcaact  18114600
<- Previous    Next ->

AGI:  At3g48820.1   
Description:  glycosyl transferase family 29 protein / sialyltransferase family protein. similar to glycosyl transferase family 29 protein / sialyltransferase family protein [Arabidopsis thaliana] (TAIR:AT1G08660.1); similar to sialyltransferase-like [Glycine max] (GB:CAJ15144.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68367.1); similar to sialyltransferase-like protein [Lotus japonicus] (GB:CAJ15148.2); contains InterPro domain Glycosyl transferase, family 29; (InterPro:IPR001675)
Range:  from: 18110714    to: 18113896    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g48830.1   
Description:  polynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein. similar to polynucleotide adenylyltransferase family protein [Arabidopsis thaliana] (TAIR:AT5G23690.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68671.1); contains InterPro domain Polynucleotide adenylyltransferase region; (InterPro:IPR002646); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 18114137    to: 18121201    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version