AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                <---------ANAC46
                                                ----------->GT1
                           <---------YAB1       <---------ZAT6
                         --------->KAN1       <---------ANAC46
                  --------->ZAT2             --------->ALFIN1                    <---------YAB1
                  <---------ZAT2             <---------AtMYB61                  --------->AHL25(2)
                  <---------At4g35610      ------>ZmHOX2a(1)                    --------->AHL20(3)
   <---------ALFIN1 --------->RAP2.6(2)<-----------HVH21                        <---------AHL25(2)
 <---------ALFIN1 <------NtERF2       --------->ANAC58                    ----------->GT1
--------->MYB46(3)--------->At4g35610 --------->ANAC46            ------>ZmHOX2a(1)        ------->MYC3
-->ARR11(2)      ----------->RAV1(1)  --------->ANAC58      <---------At4g35610 <---------AHL20(3)
---ARR11(2)  --------->ANAC58         --------->bZIP60(2)   --------->At4g35610--------->AHL12(2)
>WRI1        --------->ANAC58       <---------ALFIN1     <---------YAB5--------->GLK1(2)   <-------MYC3
 
cgaaccacacttactcaaggcagcagcaatatgcttccaacacgtcctgtggtgtaaatactcatcttcctcacaatctgtaaaattatagacacatgtt  17969600
                                                                           <-------TEIL
                                                                          <-----------GT1
                                                                      <---------AHL12(3)
                                                                      --------->AHL12(3)
                                                                      --------->AHL20(2)
                                                                     --------->AHL20(1)
                                                                     <---------AHL20(1)
                                                                     <---------AHL25(3)
                               --------->ARR11(2)                   <---------AHL12(1)
                               <---------ARR11(2)                   --------->AHL12(1)
                       --------->LBD16                              --------->AHL20(2)
                      --------->HSFB2a(2)                           --------->AHL12(3)
       ---------->DOF2<---------HSFB2a(2)                           <---------AHL12(3)        <-----
 
gatcaaacttgaaagttagcctcttccagagccagaaccaaaactttcacaaactacaaaaccagaactaaatatatatacattttcaagaaccatagat  17969700
                       --------->ANAC58                                          ----------->RAV1(1)
                       --------->ANAC46                                          <-----------HVH21
                       --------->ANAC58                                         --------->bZIP60(2)
                  <-----------ARR10                                             --------->ANAC46
                  --------->RVE1(2)                                             --------->O2
                  <---------ARR11(3)                                            --------->ANAC58
                  --------->GATA12                                      --------->YAB1
        --------->AHL20(3)   <---------ATHB12                           <---------ICU4
        <---------AHL20(3) --------->WOX13(1)           <-------MYC3   <---------YAB5
    --------->YAB1<---------GATA12        <---------KAN1------->MYC3  --------->ANAC58      --------
   <---------YAB1 --------->GLK1(2)     <---------GLK1(2) ----------->GT1       --------->ANAC58
----GATA12 --------->RVE1(2)<---------WOX13(2)  <---------ICU4        --------->ANAC58  <------ZmHOX2a(1)
 
ttcattgtcataaaaatccaaaatctaagccaattactagagagaatttcaaaattacacatggtaagatagtaagcatcaccacgacacaggaatagaa  17969800
                                                              --------->TOE1(3)                    -
                                                              --------->TOE2(3)                  <--
                                                    <---------KAN1                           -------
                                                   ------->TEIL                              <------
                    <---------HSFC1(1)             --------->ARR14(2)                      <--------
                    <---------HSFB2a(2)            --------->ARR11(2)                      ---------
               --------->KAN1                      <---------GATA12                      --------->ANAC58
    <-----------TGA1--------->HSFB2a(2)            --------->GATA12            ----------->GT1  <---
    <-----------HVH21--------->LBD16               <---------ARR11(1)          <---------ANAC58<----
   <---------bZIP60(1)                             <---------ARR14(2)          <---------ANAC58<----
   --------->bZIP60(1) ---------->DOF2            <---------ARR14(1)           <---------ANAC46-----
--->GT1  <----------DOF2 ----------->GT1          <---------CCA1(2)       <---------ICU4 --------->ANAC58
 
acaatctcgtcactttgaaaattccagaaagaaaaaaaacacaaactttcatcgaatcttcaaaaccctaactcccaaaattgcgttaaaccaagaaatt  17969900
                                                                                              ------
                                  --------->AHL12(3)                                          <-----
                                  <---------AHL25(1)                                          <-----
                                  <---------AHL12(2)                                          <-----
--------->GLK1(2)                 <---------AHL20(3)                                          <-----
<---------ARR11(3)           --------->YAB5                                                   <-----
--------->ARR11(3)       --------->DOF5.7(1)                                                <-------
-------->RVE1(1)        <---------AHL12(3)                                                 ---------
-------AHL12(2)         <---------AHL25(2)                                               <---------At4g35610
-->WOX13(2)             --------->AHL20(2)                                               -----------
---WOX13(2)             <---------AHL25(1)                          <--------ATHB1       <---------ZAT2
-ARR11(3)               --------->AHL25(2)                          --------->YAB1       --------->ZAT2
>AHL20(2)        --------->LBD16  --------->AHL20(3)               <---------ATHB51      --------->At4g35610
------AHL25(3)  --------->HSFB2a(2)     <---------HSFB2a(2)        <---------ATHB12   --------->RAP2.6(3)
-----AHL25(3)   <---------HSFB2a(2)     --------->HSFB2a(2)<---------At5g28300   --------->ZAT2  ---
-----AHL20(2)  --------->LBD16    <---------AHL12(3)      <-----------GT1   --------->ZAT6 ---------
---->AHL20(2) ----------->RAV1(1)--------->YAB1         <---------KAN1 --------->YAB1<------ZmHOX2a(1)
 
aaaaatctttcaaaaacccccagaaaaaaaaatgaataaaaatcgagaaggaaattggaatttaccatcaataatagtaacacgagcaggactgctgacg  17970000
     <---------YAB1
  <---------YAB1
<-----------GT1
--->ANAC55(2)                                                                              <--------
----ANAC58                                                                                --------->AHL25(3)
----ANAC46                                                   <---------ZAT14            <---------DOF5.7(1)
----ANAC55(1)                                                --------->ZAT18           <----------DOF2
----ANAC55(2)                                         <---------ZAT14                  <---------DAG2
----ANAC58                                         <------MYB46(1)                    <---------ANAC58
--TGA2(2)                                          <------MYB83                       <---------ANAC58
-->TGA1                                           <---------------AtSPL8          <---------ANAC58
>bZIP910(2)                                       --------->MYB59                 <---------ANAC58
---->TEIL                      ---------->ID1   >>>>>>>>>SARD1               <---------ANAC58   <---
-->HVH21             --------->YAB5             >>>>>>>>>CBP60g              <---------ANAC58  <----
 
tatttactattagtatttcgaacacgattacttcgtcttcttgacattgaaatttggtacagagagctctgagtgttttgtcttgccttgctttttattt  17970100
                                                     --------->DOF5.7(1)
                                                   ---------->DOF2
                                                <---------ANAC55(1)
                                                --------->ANAC55(2)               <----------DOF2
                                                <---------ANAC58       <---------RVE1(2)
                                                <---------ANAC55(2) <---------MYB52(1)  --------->WOX13(2)
 <---------DOF5.7(1)                            <---------ANAC46   <-------GAMYB  <---------DAG2
<---------DOF5.7(1)                             <---------ANAC58   <---------At4g35610<---------AHL20(2)
-AHL20(2)                           --------->At4g35610           <---------MYB46(3) --------->AHL20(2)
--------GT1    <---------DAG2       <---------At4g35610   <---------DOF5.7(1)  <-----------GT1   ---
-------GT1     <----------DOF2<---------YAB1 <---------KAN1<----------DOF2 <-----------GT1    ------
 
tccctcttctcttgtaaactttttgtttcgcttaatattagcagacgaattacgtaaagactcttttggccgttgattttacttactttttaatagacaa  17970200
                                                            <----------DOF2
                                                        ------->TEIL
                                                       <-----------GT1
                                                    --------------->AtSPL8
                                                   <------------CBF
                                                  --------->ATHB12
                                                  <---------AHL25(3)
                                                  <---------AHL20(2)
                                                 --------->AHL12(1)                               <-
                                                 <---------AHL25(2)                               <-
                                                 <---------AHL20(3)                               --
                                                 <---------AHL12(1)                               --
                                                 --------->AHL20(3)                               <-
                                                 <---------AHL20(2)                               <-
                                                 --------->AHL20(1)                              ---
                                                 <---------AHL20(1)                              <--
                                                 --------->AHL20(2)                              ---
                                                 --------->AHL25(3)                              ---
                                                 --------->AHL25(1)                              <--
                                                 <---------AHL25(3)              <---------AHL12(1)
                                                 <---------AHL25(1)              --------->AHL12(1)
                                                 --------->AHL25(2)              --------->AHL20(3)
                                                <---------AHL12(2)               <---------AHL20(3)
                                                --------->AHL12(2)               --------->AHL25(2)
                                               --------->AHL12(2)                <---------AHL25(2)<
                                             <---------AHL12(3)                  <---------AHL25(1)<
                                             --------->AHL25(3)                  --------->AHL25(1)-
                                             --------->AHL25(1)                 --------->AHL12(1)--
                                             --------->AHL12(1)    <---------AHL12(2)            <--
                                             --------->AHL12(3)   --------->AHL12(3)             ---
                                             <---------AHL25(1)   <---------AHL25(2)             ---
          --------->ICU4                     <---------AHL12(1)   --------->AHL12(2)             <--
       --------->WRKY18(1)                   --------->AHL20(2)   <---------AHL12(3)             <--
     ------->GAMYB                          --------->AHL25(3)   <---------AHL20(2)              ---
  --------->MYB52(1)                    <---------RVE1(2)  <---------DOF5.7(1)  <---------AHL12(1)<-
------>YAB5               <---------DOF5.7(1)<---------AHL20(2)  --------->AHL25(3)              ---
--->MYB52(1) <---------YAB1<----------DOF2 --------->AHL12(2)    --------->AHL20(2)           ------
 
cgattcaacggtcaagatgatttagtgtctctttggtttctgtgatatataatttattgaaccctttataaattttgttttgaattttttctcttaagaa  17970300
                                                                              <------MYB83
                                                                              <---------ANAC55(2)
          <------MYB46(1)                                                     ----------->GT1
          <------MYB83                                                        <------MYB46(1)
         <---------AtMYB61                                                   --------->MYB111(1)
         --------->MYB111(1)                                                 --------->MYB59
       --------->REM1(2)                                                 <---------AHL25(3)
    <---------ANAC46                                                     <---------AHL20(2)
--------AHL25(3)                                                        <---------AHL20(2)
--------AHL25(1)                                                   --------->AHL20(2)
------->AHL12(3)                                    <---------AHL25(2)  <---------AHL20(3)
------->AHL12(1)                                    <---------AHL12(3)  --------->AHL20(3)
--------AHL12(1)                                    --------->AHL12(3)  <---------AHL12(1)
--------AHL12(3)                                    <---------AHL25(3)  --------->AHL25(1)
------>AHL20(3)                                     <---------AHL20(2)  <---------AHL25(1)
-------AHL20(3)                                     --------->AHL25(1)  <---------AHL25(3)
------>AHL20(1)                                     --------->AHL25(2)  --------->AHL25(3)
------>AHL25(2)                                     <---------AHL25(1)  <---------AHL25(2)
-------AHL20(1)                                    <---------AHL20(2)   --------->AHL25(2)
---------AHL25(3)                                  --------->AHL20(2)   <---------AHL12(3)
---------AHL25(2)                                  <---------AHL20(1)   --------->AHL20(1)
-------->AHL25(2)                                  --------->AHL12(3)   --------->AHL20(2)
------->AHL25(1)                                   --------->AHL25(2)   --------->AHL12(1)
-------AHL25(2)                                    --------->AHL25(1)   <---------AHL20(1)
------>AHL12(1)                                    <---------AHL25(3)  <---------AHL12(3)
------>AHL12(2)                                    --------->AHL25(3)  <---------AHL25(2)
-------AHL12(1)                                    <---------AHL25(1)  --------->AHL12(2)
-------ARR11(3)                                    <---------AHL25(2)  --------->AHL12(3)
------>AHL25(3)                                    --------->AHL12(1) --------->WOX13(2)
--------AHL12(2)                                   <---------AHL12(1) --------->AHL12(2)
------>ARR11(3)<----------DOF2                    --------->ICU4   <---------AHL20(2)
--->AHL20(2) <-------TEIL      --------->RVE1(2)  --------->AHL12(2)<---------AHL20(2)      <-------
 
aatatttctgtgtaggtgctttgggaaaatatagaatcaaacacttatttgtaattttttttttttttttttaaatttattaggtatattttgttttgcc  17970400
                                                                                --------->AHL20(3)
                                                                                <---------AHL20(3)
                                                                                --------->AHL25(1)
                                                                                --------->AHL20(2)
                                                                            -------->HAHB4
                                                                            --------->YAB5
                                                                            --------->YAB1
                                                                           <---------YAB1
                                                                           <---------YAB5
                                                                           --------->ICU4
                                                                         --------->YAB1
                               --------->ANAC58                          <---------ICU4
                               ------>MYB83                              -------->HAHB4        -----
                               --------->ANAC46                         --------->ICU4         <----
                    ---------->DOF2  --------->GATA12                   <---------ATHB51  --------->ANAC58
                --------->ANAC58     <---------ARR11(3)    ---------->DOF2 ----------->GT1--------->ANAC58
  <---------YAB5--------->ANAC46    --------->REM1(1)--------->YAB1   --------->YAB1--------->AHL20(2)
 <-----------GT1--------->ANAC58   <-------TEIL  <----------DOF2  --------->ZAT6<---------AHL12(3)
--------->YAB1--------->ZAT6   --------->ANAC58 <---------DOF5.7(1)----------->GT1 <---------AHL12(2)
----GT1  --------->TOE2(3)     ------>MYB46(1) ------>ZmHOX2a(1)--------->MYB52(1)--------->YAB1
 
ctataaacattttcttaacactcaaaagtaaaccaagctacatcttcttcctcttttcataagaaagtaacagtaataatgataaaaataaacaagtcaa  17970500
<- Previous    Next ->

AGI:  At3g48480.1   
Description:  cysteine-type peptidase. similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT1G60220.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17206.1); contains InterPro domain Peptidase C48, SUMO/Sentrin/Ubl1; (InterPro:IPR003653)
Range:  from: 17968311    to: 17970047    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version