AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                     ----------->GT1
                                                                                     --------->HSFB2a(1)
       >>>>>>>>>MYB98                                                                <---------HSFB2a(1)
--------->YAB1                                                                       <------MYB83
---------YAB1                                                                        <------MYB46(1)
---------YAB5                                                                  ------->MYC3
-------ICU4                               <---------ANAC58                     <-------MYC2    <----
------>YAB1                               <---------ANAC58                     ------->MYC2    <----
------YAB5                          <---------ANAC58                           <-------MYC3    <----
----->ICU4                          <---------ANAC46                    ---------->DOF2    <--------
--->YAB1 --------->TOE2(3)          <---------ANAC58                --------->At4g35610    ---------
---AHL20(2)          <---------MYB46(3) <---------YAB1              <---------At4g35610    ---------
 
tcatcatagtaacataaacaaggattgttgtaagagtttgcgtatgcttgaaactacaagagtagaaactgagctaaaagcacatggaaggttactttaa  17476200
                                             <---------DOF5.7(1)
                                            ------>ZmHOX2a(1)
                                         ---------->ID1
                                      <---------DOF5.7(1)
                                      <----------DOF2                                 <---------AHL20(2)
-----YAB5                             <---------DAG2           <-----------GT1    <---------DAG2
-----YAB1                  <----------DOF2<------------------------ANAC81         <----------DOF2
-----TOE2(3)         <<<<<<<<<TBF1 <-----------GT1          <---------ICU4     <-----------GT1
--DOF2            <<<<<<<<<TBF1 --------->ANAC58      <----------DOF2     --------->TOE2(3) <-------
>TOE2(3)     <----------DOF2    --------->ANAC58 <----------DOF2          --------->YAB1    --------
>TOE1(3)    <---------DOF5.7(1) --------->ANAC46<---------DOF5.7(1)    <----------DOF2--------->AHL20(2)
 
cattggaaaaacacatctttcttcttcttcctttcaagtcacttttcctcttcttttctttcattttgacatttctttcttaatactttttaaatatgta  17476300
               <----------DOF2                     --------->ATHB12
              <---------DOF5.7(1)                  --------->YAB1
       --------->YAB1                             <---------YAB5
       --------->AHL20(2)                         <---------YAB1
      <---------ATHB51                         <---------YAB1                              ---------
     <---------WOX13(2)                     <---------AHL20(2)                     <---------bZIP60(1)
     --------->WOX13(2)                    --------->AHL20(2)     --------->YAB1   --------->bZIP60(1)
    --------->WOX13(1)                 <---------YAB1    <--------P             <---------YAB1
  <---------YAB5 --------->AHL20(2) <---------AHL20(2)<---------TOE1(2)         <---------YAB5
--ANAC55(2) --------->ARR11(3)    --------->AHL12(2)  <---------TOE2(2)<---------KAN1 --------->YAB1
->ANAC55(2) <---------ARR11(3) <---------RVE1(2)--------->YAB1 <---------WOX13(2) <---------ARR11(3)
 
atggaatcaattatagacctttatataggtgtttgatattatatgattttataatcataggttgctaaataagaatgtaagtcatgatatcatatgaata  17476400
                                                                                         <---------HSFB2a(2)
                                                                                         --------->HSFB2a(2)
                                                                                         --------->HSFC1(1)
                                                                                         <---------HSFC1(1)
                                                                                    --------->YAB1
                                                                                    --------->YAB5
                                                                                    <---------AHL12(1)
                                                                                    <--------ATHB1
                                                                                    -------->HAHB4
                                                                                    <---------ICU4
                                                                                    <---------AHL25(3)
                                                                                    --------->AHL12(1)
                                                                                   <---------YAB1
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL12(3)
                                                                                  <---------AHL20(3)
                                                                                  <---------AHL12(2)
                                                                                  --------->AHL12(2)
                                                                                  --------->AHL12(3)
                                                                                  --------->AHL25(2)
                                                                                  <---------AHL25(2)
                                                                                 <---------AHL25(3)
                                                                                 --------->YAB1-----
                                                                                <---------AHL12(1)
                                                                               --------->AHL20(3)
                   --------->ANAC46                                            <---------AHL25(2)
                 --------->ANAC46                                  --------->ANAC58<---------YAB5
                ------->GAMYB                                      --------->ANAC46--------->ICU4  <
    --------->ANAC58                           <---------ATHB12    --------->ANAC58<---------ATHB51-
    --------->ANAC46     <---------ICU4      --------->WOX13(1) <-------TEIL   --------->AHL25(2)  -
    --------->ANAC58    <---------YAB5    --------->YAB1    <-------TEIL       --------->AHL20(2)  <
>YAB5  ---------->DOF2--------->YAB1--------->ANAC46   ---------->DOF2         <---------AHL20(3)---
 
caatcccaagcaaagacaacacacatcatcatgttctcccctcaataacaatcacttgcaaagtacatacacacaaactcaaaataataattctagaaaa  17476500
            <---------AHL25(3)
            <---------AHL20(2)
           --------->AHL25(3)
           --------->AHL20(2)
           --------->AHL25(1)
           <---------AHL20(3)
           --------->AHL20(3)
           <---------AHL20(2)
           <---------AHL25(1)
           --------->AHL25(2)
           --------->AHL20(1)
         <---------WOX13(2)
         --------->WOX13(2)
     --------->WOX13(2)
     <---------WOX13(2)
    <-----------GT1
 --------->AHL12(2)
 <---------AHL12(2)
--------->YAB5
--------->ATHB51
<--------HAHB4
--------->YAB1                            <---------WOX13(2)
-------->ATHB1                            --------->WOX13(2)        ------------>CBF
<---------ICU4                        <---------WOX13(2)       <---------HSFC1(2)
--------->AHL20(2)                    --------->WOX13(2)       --------->HSFB2a(1)
------->CBF<---------AHL20(1)       --------->AHL20(2)         <---------HSFB2a(1)
---------ATHB51                   <---------DOF5.7(1)          --------->HSFC1(2)                <--
-------->ICU4                     --------------->AGL15    --------->ANAC58                      ---
-------->AHL25(3)  --------->ANAC46 <---------AHL20(2)     --------->ANAC58                ---------
---------YAB1 --------->WOX13(2)  <---------------AGL15    --------->ANAC46                ---------
------>YAB5<---------AHL25(2)     <----------DOF2     --------->ANAC46    *TSS             ---------
 
caattattaactaatttaatatacaaaactaaattccctttaattagttaagacatcacaccaagaaacttctcaattccccatacaaactcatacccaa  17476600
                                                                             <-------TEIL
                                                                           <---------SPL7(1)
                                                                          <---------ANAC46
                                                                          --------->DEAR3(1)
                                                                        --------->LBD16            <
                                                                        ------>NtERF2              -
                                                                       --------->ANAC46           --
      --------->AHL20(2)                                               ------------------>SPL14  <--
-------ARR11(3)         <----------DOF2                                --------->DEAR3(1)  ---------
------>ARR11(3)        <---------DOF5.7(1)           <<<<<<<<<TBF1   <---------ATERF1(1)  <---------
>ANAC46               <---------KAN1            <---------CCA1(2)    ------>ZmHOX2a(1)   <---------ANAC58
>ANAC58    --------->YAB5                    <------NtERF2     <---------MYB52(1)        <---------ANAC58
>ANAC58--------->DOF5.7(1)                ---------->ID1   <---------At5g28300  <---------YAB1<-----
 
gaacttcaaaaaaatgcttagaggcatctttcacatttgcctcttggcctcatttcttcttctaccgttctcctccgccgtacatgatagtggcttcacc  17476700
                                                                  --------->MYB46(3)
                                                                  <---------MYB55(2)
                                                                 ------>MYB46(1)
                                                   --------------->AtSPL3
                                                 --------->ARR14(2)
                                                 --------->ARR11(2)     <---------ZAT2
                                           ----------->RAV1(1)   -------->P
                       --------->TCP15(1) --------->AtMYB61      ------>MYB83
   --------->DEAR3(2)  <---------PCF5     <---------ALFIN1   --------->ANAC46
 <---------ARR11(2)    --------->TCP20   <---------MYB55(2)------>MYB46(1)
 --------->ARR11(2)    <---------PCF2    --------->MYB46(3)------>MYB83 --------->ZAT2
<---------SPL7(1)   --------->ALFIN1    ------>NtERF2--------->ZAT18  <---------ALFIN1             <
---------MYB46(3)  --------->LBD16     <---------ALFIN1  <---------ALFIN1                        ---
-------->ABI4(2)  <---------ANAC46     --------->ANAC46  --------->AtMYB61                      ----
------->ALFIN1    <---------ANAC58    --------->MYB46(3) --------->DEAR3(1)                     ----
-------MYB52(1)   <---------ANAC58<-----------GT1<---------ARR14(2)------->GAMYB                ----
-->HVH21        ------>ZmHOX2a(1) --------->ARR11(2)--------->RAP2.6(2)------>NtERF2           -----
-DOF2        ------>ZmHOX2a(1)  --------->YAB5  ---------->DOF2 <---------ALFIN1             <------
----LBD16   <---------ALFIN1   <---------YAB5 --------->ANAC46 <---------ALFIN1            ---------
 
ggtggtaccgatgctcctcctccgtgggaccataatgtttccccaccaccagaaaccgcaccatccccaacccccacctcgagtccctctacaacctcac  17476800
                    --------->ANAC46
                    --------->ANAC58
                    --------->ANAC58
                   <------NtERF2
                   --------->ATERF1(1)
                   --------->At4g35610
                  <---------RRTF1(1)
                  <---------RAP2.3(1)
                  <---------ERF1
                  <---------ATERF1(1)
                 <---------RAP2.3(2)
                 <---------DEAR3(1)
                 <---------RAP2.3(3)
                --------->ATERF1(1)
                <---------At4g35610
                <------NtERF2
                --------->At4g35610
               --------->MYB55(2)
       ----------->HVH21
      --------->HSFB2a(2)
      <---------HSFB2a(2)                                                                        ---
      --------->LBD16------>NtERF2                                                               ---
      =================================HOX2a_HOX2a            <---------bZIP60(2)                ---
      ------>ZmHOX2a(1)   --------->RVE1(2)                ----------->HVH21                   -----
    ----------->RAV1(2)<---------ALFIN1              --------->LBD16                          <-----
---------ALFIN1<---------ATERF1(1)                  --------->HSFB2a(2)                  <----------CDC5
--->NtERF2     ------>NtERF2                        --------->LBD16                    --------->ANAC46
----->ANAC46   <---------MYB46(3)                  <---------ANAC46                    --------->ANAC58
----->DEAR3(1)<---------DEAR3(1)              <-----------HVH21    <---------DEAR3(1)<---------ALFIN1
----->DREB2C(2)--------->ABI4(2)     --------->MYB52(1)------>NtERF2<---------MYB46(3) --------->ANAC58
---->MYB46(3) --------->ALFIN1      --------->MYB46(3)----------->HVH21  ----------->RAV1(1)--------
---ALFIN1    <---------MYB52(1) <------ZmHOX2a(2)  <---------LBD16 <---------AtMYB61<---------REM1(2)
>AtMYB61<---------WRKY18(1)    --------->GATA12   <---------LBD16  --------->ALFIN1<---------ALFIN1
 
cgccatctcctggaccggtggctgcgccatctccgatcaacaacggctctgtctccggggacatgacatggtggtgcaacaagactccacacgctgagac  17476900
                                                      --------->ARR11(2)
                                                      --------->ARR14(2)
                                                      <---------ARR14(2)
                                                    <---------HSFB2a(1)
                                                    <---------HSFC1(2)
                                              --------->AtMYB61
      <---------------AGL15                  --------->MYB46(3)                    <---------WRKY38(1)
   --------->YAB5                         --------->MYB46(3)                       <---------WRKY12
   <---------ICU4       --------->ANAC46 ------>MYB83 <---------ARR11(2)          --------->WRKY18(1)
  --------->ICU4     --------->ZAT18     ------>MYB46(1)                      <---------ANAC58  >>>>
------>AtLEC2      <---------At4g35610   --------->SPL7(1)        <---------ARR11(3) <---------TOE2(3)
------>ANAC58      --------->At4g35610 --------->TOE1(2)   <-----------HVH21  <---------ANAC58  >>>>
------>ANAC58--------->LBD16           --------->TOE2(2)<---------LBD16 <---------ANAC55(2)     <---
---->KAN1   <---------HSFB2a(2)  --------->TOE2(3)  --------->HSFC1(2)  <---------ANAC46        >>>>
----RVE1(2) --------->HSFB2a(2)  --------->TOE1(3)  --------->HSFB2a(1) --------->ANAC55(2)    -----
--->ARR10  <---------LBD16    ----------->RAV1(1)  <---------TOE2(3)   <---------LBD16         -----
 
atgcaattactacttccggaagagctcacaaaacaacattaacctacgaccaccaaggttccggtccgagttcttacggatgctggtcaaggtagcactt  17477000
                                                         ---------->DOF2
                                                         --------->MYB52(1)
                                                       --------->MYB46(3)
     --------->LBD16                                  --------->ANAC58
    <---------ANAC58                                  --------->ANAC58
    <---------ANAC58                                 ------->GAMYB
 --------->ANAC46                                   --------->MYB46(3)
 --------->ANAC58                                   <---------MYB111(1)
 ------>MYB46(1)                                    <---------MYB111(2)
 --------->ANAC58                                   <---------MYB55(2)
 ------>MYB83                             <---------ZAT2--------->AtMYB61<-----------HVH21     <----
>>>>>>WRKY43                              <---------At4g35610   --------->DOF5.7(1)            -----
>>>>>>WRKY26                              --------->At4g35610 ---------->DOF2     ----------->GT1
------WRKY18(1)            <---------MYB52(1)      ------>MYB46(1)      <------MYB83  <---------CCA1(2)
>>>>>>WRKY38       --------->WRKY18(1)    --------->ZAT2------->GAMYB   <------MYB46(1)--------->GATA12
---->WRKY38(1)    <-----------HVH21    XXXXXXXXXXXXXXXXXXXX>MIR171A  <---------MYB52(1)<---------GATA12
------>HVH21  --------->ANAC46<---------TOE2(3)    ------>MYB83<---------GLK1(1)  <---------ANAC46
 
gaccaagccgtgatcacacacagtcaaaccgttaagtttggaccgagctgcaccaacaaccaaaggaaagccgcttggtcagactgcgtaaatctcttcc  17477100
<- Previous    Next ->

AGI:  At3g47400.1   
Description:  pectinesterase family protein. similar to pectinesterase family protein [Arabidopsis thaliana] (TAIR:AT5G51490.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42679.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain Pectinesterase, catalytic; (InterPro:IPR000070); contains InterPro domain Pectin lyase fold/virulence factor (InterPro:IPR011050); contains InterPro domain Pectinesterase inhibitor; (InterPro:IPR006501)
Range:  from: 17476575    to: 17479103    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version