AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                              --------->RAP2.6(2)
                                                              --------->RAP2.3(2)
                                                              <---------ANAC46
                                                              ----------->GT1
                                                             --------->RAP2.3(1)
                                                             <------NtERF2
                                                            <---------ATERF1(1)
                                                           --------->RRTF1(2)
                                                           --------->RAP2.3(3)
                                                           --------->ATERF1(2)
                                                           ------------------>SPL14
                                                           --------->DEAR3(1)
                                                           --------->DREB2C(2)
                                                           --------->RAP2.6(2)
                                                           <---------DEAR3(1)
                                                           --------->RRTF1(3)
                                                          --------->RAP2.6(1)
                                                          --------->ATERF1(1)
                                                          --------->RRTF1(1)
                                                          --------->DEAR4(2)
                                                          --------->ERF1
                                                          --------->RAP2.3(1)
                                                         <---------ATERF1(1)
                                                         ------>NtERF2
                                                         --------->ABI4(1)
                                                        --------->DEAR3(1)
                                                        --------->ANAC46
                                                       --------->MYB46(3)
                                                     <---------ALFIN1                             <-
                                            --------->ATERF1(2)           <---------ANAC46        --
                                            <---------HSFB2a(2)           <---------ANAC58        --
                                            <---------ANAC46--------->ABI4(1)        --------->GATA12
                <---------TOE2(3)           <---------ATERF1(2)--------->LBD16   <-------GAMYB    ==
           --------->ATHB12                 --------->HSFB2a(2)--------->At5g28300   <---------GATA12
          <---------YAB1                   <---------LBD16--------->ORA47(2)<---------KAN1        <-
          --------->ICU4         --------->SPL7(1)  <---------KAN1  --------->DOF5.7(1)      -------
        -------->HAHB4           ------->TEIL--------->LBD16------>NtERF2 <---------ANAC58  <-------
        <---------ICU4           <---------ARR11(2)<-----------HVH21--------->DAG2 --------->WRKY38(1)
        --------->YAB5         <---------ZAT18    --------->YAB1   --------->DOF5.7(1) ------>ZmHOX2a(2)
       <---------YAB1          <---------SPL7(1)--------->ANAC58   =================================
       --------->ICU4         <---------ANAC58  --------->ANAC58   ---------->DOF2 --------->WRKY12<
->ALFIN1--------->YAB1        <---------ANAC58<------NtERF2--------->RAP2.3(2)   ===================
 
gcaagtgaaaatgattattgaagttatcgctaagcgtacccatagtgccggaagcatcaccgccgccgtaaaaagtggcatgagcgttgatccaaggtcc  11014200
                                  --------->RAP2.6(2)
                    ------>NtERF2 --------->DEAR3(1)
                    <------NtERF2--------->ATERF1(1)
                   --------->ANAC58
                   --------->ANAC58
                   --------->ANAC46------>NtERF2
            <---------AtMYB61   <---------At4g35610
        --------->LBD16 --------->ANAC46
        ------>NtERF2   ----------->HVH21
      <---------LBD16   =========================================bZIP_DOF
    --------->DEAR3(1)  --------->O2
   --------->MYB46(3)   <---------O2
   --------->DEAR3(2)   <---------TGA1a
----------->HVH21 --------->ZAT18--------->MYB46(3)
--------TGA1a<------MYB83       <---------ATERF1(1)           <------ZmHOX2a(1)
------->O2 =======================MYC_MYB              --------->DAG2
------->TGA1a<------MYB46(1)    --------->At4g35610    --------->DOF5.7(1)
====================MYC_MYB <---------DEAR3(2)   --------->ANAC58
--------O2 <--------P   --------->TGA1a         <---------------------WRI1
-->PCF2--------->LBD16 ------>NtERF2          --------->DEAR3(1)--------->At4g35610
----HVH21<------NtERF2<---------ALFIN1 ----------->HVH21  --------->TOE1(2)
========bZIP_DOF  --------->SPL7(1)<---------RAP2.6(3)--------->DOF5.7(1)   ---------->DOF2
-----------HVH21 --------->ATERF1(1)<------NtERF2--------->ANAC58     --------->MYB46(3)
========MYC_MYB <---------SPL7(1)--------->RAP2.3(1)  ---------->DOF2------->TEIL                  <
 
catgtgaccgccgggatggtgtccgccacgacggtagccgccctgaacgcagacggaaaaagctaggagatgaaccacgagaagcgagattactaaaact  11014300
                                                                                                  <-
                                                                                                  <-
                                                                                                  <-
                                --------->DOF5.7(1)                                               <-
                              ---------->DOF2                                                     <-
                    --------->YAB5                                                               ---
        --------->ANAC58   --------->ANAC58                                                      ---
        ----------->GT1    --------->ANAC58     --------->DOF5.7(1)                  --------->GATA12
        --------->ANAC58   --------->AtLEC2    --------->MYB52(1)                    <---------GATA12
   <---------ANAC46 --------->YAB1            ---------->DOF2                     <------ZmHOX2a(1)
---------TOE1(2) --------->WOX13(1)  ----------->GT1     --------->AHL12(2)   <---------KAN1     <--
 
cccatgttgtgaagcaaaaacaatcacaacatgcaaaggagagaaaaaacaaagggtgttttttttttgtcaaaatacagaatgaggagatgtgagaagt  11014400
        ------->TEIL
<---------ANAC46                                                                  --------->YAB1
--------ANAC58                                                                   <---------ATHB12
-----MYB46(1)                                                                  --------->WOX13(1)
--------ANAC58                                                               <---------YAB5    <----
-----MYB83                                               ---------->DOF2    ------->TEIL   ---------
--------ANAC46                                   <---------ARR14(2)       --------->YAB5   ---------
------>MYB46(2)                                  --------->ARR14(2)      --------->ICU4    ---------
------>MYB111(2)              ----------->GT1   <------ZmHOX2a(1)        <---------YAB5    ---------
-------AtMYB61     >>>>>>>>>TBF1         <------ZmHOX2a(1)           --------->At5g28300<-------TEIL
 
ttggtgtgatgaaactggagaagaagaagagagtggtataaataggaagaaggattcagacaaagttttagcggtaatgaatcaatcagggtccatgcaa  11014500
                                --------->AHL12(2)
                              <---------AHL12(1)
                              <---------AHL20(2)
                              --------->AHL20(2)
                              <---------AHL25(3)
                              --------->AHL12(3)
                              <---------AHL12(3)
                              <---------AHL25(2)
                              --------->AHL25(2)
                              <---------AHL25(1)
                              --------->AHL25(1)
                             <---------AHL20(2)
                             <---------AHL20(1)
                             --------->AHL25(3)
                             --------->AHL20(2)
                             <---------AHL25(2)
                             --------->AHL12(3)
                             --------->AHL25(1)
                             --------->AHL20(3)
                             <---------AHL20(3)
                             <---------AHL25(1)
                             --------->AHL25(2)
                            <---------AHL12(2)
                            --------->AHL12(2)
                           <---------WOX13(2)
                           --------->WOX13(2)
                         --------->AHL25(3)
                        <---------AHL20(2)                               --------->DOF5.7(1)
                        --------->AHL20(3)                               --------->DAG2
                        --------->AHL25(2)                              ---------->DOF2
                        <---------AHL20(1)                         --------->RVE1(2)
                        <---------AHL20(3)                   <---------------------WRI1
                        <---------AHL25(2)                 --------->TOE1(2)
 --------->ATHB12       --------->AHL20(2)                 --------->DEAR3(1)         --------->YAB5
<----------DOF2        --------->YAB1                      --------->TOE2(2)          --------->TOE2(3)
<---------YAB1        <---------YAB1                      --------->MYB46(3)          --------->YAB1
-----At4g35610      <---------ICU4                      --------->ARR14(2)           ----------->GT1
>ANAC46            --------->ICU4                       --------->ARR11(2)     ----------->GT1
>ANAC58        --------->ZAT14--------->AHL12(1)        <---------ARR14(2)     <------MYB83
>AtLEC2        <---------ZAT14--------->AHL25(3)        <---------ARR11(2)--------->DOF5.7(1)<------
>ANAC58   <---------ZAT14<---------YAB1   ----------->GT1 --------->DEAR3(2)   <------MYB46(1)*TSS
 
ctgcttattggtcttcactatacttattataatttaatttttgaagggtttaacatgtagaaccgacgaaaatcaaaaaggaaggtgaatgttaatatgt  11014600
                                                                                  --------->KAN1
                                                                                 <---------RVE1(2)
                                                                                 <---------ARR11(3)
                                                                            <---------ARR14(2)
                                                                            --------->ARR11(2)
                                                                            --------->RVE1(2)
                                                                         <---------ANAC55(2)
                                                                         <---------ANAC58
                                                                   <---------AHL12(3)
                                                                   <---------AHL25(1)
                                                                   --------->AHL20(2)
                                                              ----------->GT1    --------->ARR11(3)
                                                        --------->ANAC58 --------->ANAC55(2)
                                                <-----------HVH21  <---------AHL20(2)           <---
                  ----------->GT1             --------->DOF5.7(1)  --------->AHL25(1)         <-----
                <---------AHL12(2)          ---------->DOF2 <------------CBF<---------ARR11(2)------
                <------------CBF    <---------KAN1  --------->ANAC58 --------->KAN1 <---------YAB1
        ---------->DOF2--------->ICU4    --------->YAB1 --------->ANAC58 <---------ANAC58  <--------
---ANAC55(2)  --------->AHL12(1)   --------->GATA12 --------->ANAC58<---------AHL25(3)     ---------
 
aagagttggaccaaagaaaaattgtcaaaatgagttggaatctatcgtaaaggtcactcaagaaattgaaataaatgcgtatcagatattagtggatgtg  11014700
                                <---------DOF5.7(1)
                                <----------DOF2
                               <---------DOF5.7(1)
                          <-----------GT1
                         <-----------GT1
                      <---------AHL25(1)
                      --------->AHL25(1)
                      --------->AHL20(3)
                      <---------AHL20(3)
                     --------->AHL12(1)                             ------>ZmHOX2a(1)
      ----------->GT1<---------AHL12(1)                      <---------ARR14(2)
  <---------RVE1(2)  --------->AHL25(3)                      --------->ARR11(2)
<---------ZAT6      <---------RVE1(1)                        --------->ARR14(2)
<---------YAB5     <---------GLK1(2)                     <---------YAB5
------RVE1(2)      <---------ARR11(3)                    <---------YAB1
----YAB1           --------->ARR11(3)   --------->AHL20(2)--------->YAB1
----->HVH21        <---------RVE1(2)<----------DOF2    <-----------GT1         --------->ATHB12
-GATA12      <---------YAB1    <---------DAG2  ---------->DOF2--------->KAN1  --------->ICU4
>GATA12     --------->TOE2(3) <---------DOF5.7(1)      --------->YAB1         <---------YAB1
 
atagtgatactgtaacattatagatttttttccccctttctttttatatagaaagtatttatcatatactcctatggagacatgatttgcaatagcattt  11014800
                                                                 ----------->GT1
                                                                 --------->LBD16
                                                               <---------LBD16
                                                             <-----------GT1
                                                            --------->KAN1
                                                          <---------AHL20(3)
                                                          --------->AHL25(2)
                                                          <---------AHL25(2)
                                                          --------->AHL20(3)
                                                        <---------AHL25(2)
                                                        --------->AHL20(1)
                                                        <---------AHL12(2)
                                                        <---------AHL12(3)
                                                        --------->AHL20(3)
                                                        --------->AHL25(2)
                                                        <---------AHL20(3)
                                                       <---------AHL25(3)
                                                       <---------AHL25(2)
                                                       --------->AHL20(2)
                                                       --------->AHL12(3)                      -----
                                                       <---------AHL12(3)                      -----
                                                       --------->AHL25(2)                      <----
                                                       <---------AHL25(1)                      <----
                                                       --------->AHL25(1)                      -----
                    <---------ANAC46                   --------->YAB1                          <----
          <---------YAB1                              <---------AHL20(2)                      ------
        --------->YAB1                                --------->AHL12(1)                      ------
        <---------ICU4                              --------->AHL12(2)                        ------
       --------->ICU4                               <---------AHL12(2)           --------->RVE1(2)
      --------->WOX13(2)                           <---------AHL20(2)            --------->GLK1(2)
      <---------AHL12(2)                           <---------AHL25(3)           <---------GLK1(2)<--
      <---------WOX13(2)                           --------->AHL20(2)    --------->DAG2       <-----
     --------->AHL12(2)                           --------->AHL20(2)    ---------->DOF2       <-----
    --------->AHL20(2)                           <---------WOX13(2)   <---------WOX13(2)      ------
 --------->YAB1     <---------ANAC58             --------->AHL12(2)  --------->YAB1           <-----
<-------TEIL        <---------ANAC58             --------->WOX13(2) <---------KAN1            <-----
 
acattcataaattatgagggtttgagtgtttgagacagacaatatagagcttaataaataatattatccggataataaagttagaatctaaatgcaatat  11014900
                            <---------WOX13(2)
                          --------->AHL12(1)
                          <---------AHL12(1)
                          --------->AHL20(2)
                          --------->AHL12(3)
                          <---------AHL25(3)
                          <---------AHL20(2)
                          <---------AHL12(3)
                          <---------AHL25(1)
                          --------->AHL25(1)
                         <---------AHL20(1)
                         --------->AHL20(1)
                         --------->AHL20(2)
                         <---------AHL25(1)
                         <---------AHL20(2)
---->AHL12(3)            <---------AHL25(2)
---->AHL25(2)            --------->AHL25(2)
-----AHL25(2)            --------->AHL25(1)
-----AHL12(3)            --------->AHL25(3)
---->AHL12(2)            --------->AHL12(1)
-----AHL12(2)            <---------AHL12(1)
--->AHL20(3)       --------->ANAC46
--->AHL25(2)       --------->ANAC58
--->AHL12(1)       --------->ANAC58
-------AHL20(2) --------->ZAT14             <---------AHL20(2)
----AHL12(1)    <---------ZAT18            <---------YAB1                        <---------WOX13(2)
----AHL25(2)    <---------ZAT14            --------->AHL25(3)                    --------->WOX13(2)
--->AHL20(1)    --------->ZAT18           --------->AHL12(2)        <----------DOF2
----ARR11(3) <---------At5g28300          --------->AHL12(3)  <----------DOF2 --------------->AGL15
----AHL20(1)<-----------GT1 --------->WOX13(2)          ----------->GT1      --------->TOE2(3)
 
tttttggtccaagttttactgcacacaatttatttaagaagacatatttattgtatgtctggttacttttacttttgttttcttaatttgttagaaattg  11015000
                                        <------MYB83
                                        <------MYB46(1)
                  --------->At4g35610 <--------P
               <---------At4g35610    <---------MYB52(1)
               --------->At4g35610  <---------MYB46(3)              --------->ATHB12
          <---------LBD16        ------------>AtMYB77              <---------YAB5        --------->At4g35610
        --------->ARR11(2)       --------->MYB52(1)           --------->GATA12           <---------At4g35610
        <---------ARR11(2)----------->GT1        --------->YAB1   <-----------HVH21      <---------ZAT2
----------->RAV1(1)      --------->ALFIN1    <----------DOF2  <---------GATA12        <-------TEIL
 
gagcaacattgtattcggagcagaagaagtggtgaagaacggttgggacttttcataaaactgtagatgtgtcattggacaaaaatgggtacagctgttt  11015100
<- Previous    Next ->

AGI:  At3g29030.1   
Description:  ATEXPA5 (ARABIDOPSIS THALIANA EXPANSIN A5). Identical to Expansin-A5 precursor (EXPA5) [Arabidopsis Thaliana] (GB:Q38864); similar to ATEXPA15 (ARABIDOPSIS THALIANA EXPANSIN A15) [Arabidopsis thaliana] (TAIR:AT2G03090.1); similar to alpha-expansin [Cicer arietinum] (GB:CAC19183.2); contains InterPro domain Expansin 45, endoglucanase-like (InterPro:IPR007112); contains InterPro domain Rare lipoprotein A (InterPro:IPR005132); contains InterPro domain Expansin/Lol pI; (InterPro:IPR007118); contains InterPro domain Expansin; (InterPro:IPR002963); contains InterPro domain Pollen allergen/expansin, C-terminal (InterPro:IPR007117); contains InterPr
Range:  from: 11012545    to: 11014595    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version