AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                             --------->AHL20(1)
                                             --------->AHL25(1)
                                             <---------AHL25(2)
                                             --------->AHL25(2)
                                             <---------AHL25(3)
                                             --------->AHL25(3)
                                             --------->AHL12(1)
                                             <---------AHL12(1)
                                             <---------AHL25(1)
                                             --------->AHL20(2)
                                             <---------AHL20(3)
                                             <---------AHL20(1)
                                             <---------AHL20(2)
                                            <---------AHL12(3)
                                            --------->AHL12(3)
                                            --------->AHL25(1)
                                            --------->AHL25(3)
                                            --------->AHL20(2)
                                            <---------AHL25(1)
                                  --------->AHL25(2)
                                  <---------AHL20(3)
                                  --------->AHL25(3)
                                  <---------AHL12(1)                                               <
                                  --------->AHL12(1)                                               <
                                  <---------AHL25(2)                                              <-
                                  --------->AHL20(3)                                              <-
                                  --------->AHL20(1)                                              --
                                  <---------AHL20(1)                                              <-
                                  <---------AHL20(2)                                              --
                                  --------->AHL20(2)                                              --
                               --------->AHL20(3)                                                 --
                               <---------AHL20(1)                                   --------->AHL20(2)
                               <---------AHL20(3)                                   --------->AHL12(3)
          --------->TOE2(3)    --------->AHL20(2)                                   --------->AHL20(3)
-------->HSFB2a(2)             --------->AHL25(1)                                   <---------AHL20(3)
---------HSFC1(1)              <---------AHL25(1)                                   --------->AHL25(1)
---------HSFB2a(2)             --------->AHL25(3)                         --------->ANAC58        --
----->ARR11(3)                 --------->AHL25(2)                     <---------KAN1--------->AHL25(2)
------ARR14(2)                 <---------AHL20(2)                    <-----------ARR10            --
----->RVE1(2)     <---------DAG2 <---------AHL12(2)           --------->KAN1        <---------AHL12(3)
-----CCA1(2)      <----------DOF2--------->AHL12(2)         <---------KAN1--------->ANAC46        <-
---GT1    --------->RVE1(2)    --------->AHL20(1)         --------->YAB1  --------->ANAC58    <-----
 
atctagaagacaacatcaaaactttttgatgcaataaaatattagaaataaattcaaacaagaataaatgcgaatttaagccaaaaaaaaaatactagga  10566600
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->YAB1
                                                                                      <---------AHL20(2)
                                                                                    --------->AHL12(2)
                                                                                    --------->WOX13(2)
                                                                                    <---------AHL12(2)
                                                                                    <---------WOX13(2)
                                                                                   <---------AHL12(3)
                                                                                   --------->AHL20(3)
                                                                                   <---------AHL20(2)
                                                                                   <---------AHL20(3)
                                                                                   --------->AHL25(2)
                                                                                  --------->AHL25(2)
                                                                                  <---------AHL25(3)
                                                                                  <---------AHL20(1)
                                                                  --------->KAN1  --------->AHL12(1)
                                                                 <---------AHL20(1)--------->AHL25(1)
                                                                 --------->ARR11(3)--------->AHL12(3)
                                                                 <---------ARR11(3)--------->AHL20(2)
                                                         <---------AHL20(2)       --------->AHL20(2)
                                                         <---------YAB1           <---------AHL12(1)
                                                         <---------AHL25(1)       <---------AHL25(1)
                                                         --------->AHL25(1)       <---------AHL25(2)
                                                         --------->AHL20(2)       --------->AHL25(1)
                                                        --------->AHL25(3)        <---------AHL12(3)
                                                       --------->AHL12(2)         <---------AHL20(2)
                                                       <---------AHL12(2)         --------->AHL25(3)
                                                      <---------AHL25(3)          --------->AHL12(3)
                                                      <---------AHL20(1)        --------->AHL12(2)
                                                     <---------AHL12(1)         <---------AHL12(2)
                                                     --------->AHL12(3)         --------->WOX13(2)
                                                     --------->AHL20(2)        <---------AHL25(3)
        ---------->DOF2                              <---------AHL12(3)        <---------ICU4
       <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)          --------->AHL12(3)          --------->YAB5
    <-----------GT1                                <---------AHL12(2)         <---------AHL25(1)
---------AHL12(2)                                  <---------AHL12(3)         <---------AHL20(2)
---------YAB1  <---------ANAC58                  --------->AHL20(2)           --------->AHL25(1)
--------AHL20(1)                                 <---------AHL25(1)           --------->AHL20(2)
--------AHL20(3)                                 <---------AHL20(2)           --------->AHL25(3)
------->AHL25(2)                           --------->RVE1(2)   <---------RVE1(2)<---------WOX13(2)
--------AHL25(2)                        --------->AHL12(3)  <---------WOX13(1)<---------ATHB51
------->AHL25(3)                        <---------AHL20(3) <---------WOX13(2) <---------ATHB12     -
------->AHL25(1)                      <---------YAB1 --------->AHL12(1)       <---------AHL12(1)  <-
------->AHL20(3)                    --------->AHL20(2)--------->AHL20(1)      --------->ICU4      <-
------->AHL12(2)           --------->ARR11(3)    --------->AHL25(3)     --------->AtLEC2 <---------YAB1
------->AHL20(1)           <---------AHL20(1)    --------->AHL25(1)  <-------TEIL--------->AHL25(3)<
--------AHL20(2)      --------->AHL20(2)--------->AHL20(3) --------->WOX13(2) --------->AHL12(1)----
-ZmHOX2a(1)    <---------ANAC58     --------->YAB1<---------AHL25(3) <---------YAB5<---------AHL25(3)
 
ttatatttcaccaaagtttcttacatataatatatacaattataaatatcaaataaatatataattgatatattcatacaaataattaatttatgatatt  10566700
                                                    <---------AHL20(3)
                                                    --------->AHL20(3)
                                                    <---------AHL20(2)
                                                    --------->AHL20(2)
                                                    --------->AHL25(1)
                                                    --------->AHL20(1)
                                                    <---------AHL20(1)
                                         <---------AHL12(2)
                                       <---------AHL12(1)
                                       --------->AHL20(1)
                                       --------->AHL12(1)
                                       <---------AHL20(1)
                                       <---------AHL25(2)
                                       --------->AHL20(2)
                                       --------->ARR11(3)
                                       <---------AHL25(1)
                                       --------->AHL25(2)
                                       --------->AHL25(3)
                                       <---------AHL25(3)
                                       <---------ARR11(3)
                                       --------->AHL25(1)
                                       <---------AHL20(3)
                                       --------->AHL20(3)
                                       <---------AHL20(2)
                                      --------->AHL12(1)
                                      --------->AHL12(2)
                                      <---------AHL12(2)
                                      <---------AHL12(1)
                                      --------->AHL12(3)
                                      --------->AHL20(2)
                                      <---------AHL12(3)
                                     <---------AHL12(2)       <---------ANAC46
                                     --------->AHL12(2) --------->ATHB12
                                    --------->AHL12(3) <---------YAB1
                                    --------->AHL25(2) <---------AHL25(1)
                                    <---------AHL12(3) --------->AHL20(3)
   --------->ATHB12                 --------->AHL20(2) <---------AHL20(2)
-ARR11(3)                           <---------AHL12(2) <---------AHL20(3)     --------->ANAC55(2)
-RVE1(2)                  <---------ARR14(2)        <---------AHL25(1)        --------->ANAC58
>ARR11(3)                 <---------GLK1(2)         <---------AHL25(2)        --------->ANAC46
-------->ATHB12           <---------RVE1(2)         --------->AHL25(2)      <-----------GT1
--------YAB1              --------->ARR11(3)       --------->YAB1 <---------ZAT6
--------YAB5              --------->ARR14(2)  --------->YAB1  <---------ANAC58--------->ANAC58
---------ICU4            <------ZmHOX2a(1)<---------AHL20(2)  <---------ANAC58<---------ANAC55(2)
----->YAB1      --------->YAB5    --------->AHL20(2)<---------AHL25(3) <---------YAB1
 
gatcattgatgggattaaacgattaataggattttcaaaaaatatattatcgtattatattattgacttgtgttatgttttacgcaagtttcaacttgaa  10566800
                                                                                        <---------TOE1(3)
                                                                                        <---------TOE2(3)
                                                                                    <---------WOX13(2)
                                                                                    --------->WOX13(2)
                                                                                    <------------CBF
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL25(1)
                                                                                  <---------AHL25(1)
                                                                                  <---------AHL25(3)
                                                                              --------->AHL20(3)
                                                                              <---------AHL25(3)
           <---------AHL25(2)                                                 --------->AHL20(2)
           <---------AHL20(2)                                                 <---------AHL12(1)
           --------->AHL20(3)                                                 <---------AHL20(2)
           --------->AHL25(2)                                                 --------->AHL25(1)
           <---------AHL20(3)                                                 <---------AHL20(3)
          --------->AHL12(1)                                                  <---------AHL25(1)
         <---------YAB1                                                       --------->AHL12(1)
        --------->AHL12(2)                                                    --------->AHL12(3)
        <---------AHL12(2)                                                    <---------AHL12(3)
       <---------AHL25(3)                                                    --------->AHL25(3)
      <---------AHL20(2)                                                     <---------AHL20(2)
      --------->AHL20(2)                                                    --------->AHL12(2)
      <---------AHL20(1)                                                   --------->AHL12(2)
      --------->AHL20(1)                                                   <---------AHL12(2)
      --------->AHL25(3)                                                  <---------AHL25(1)
      --------->AHL20(3)                                                  --------->AHL12(1)
      --------->AHL25(2)                                                  --------->AHL20(2)
      <---------AHL25(2)                                                  <---------AHL25(3)
      <---------AHL25(3)                                                  <---------AHL12(1)
      <---------AHL20(3)                                                  <---------AHL20(3)
      <---------AHL25(1)                                                  <---------AHL20(2)
      --------->AHL25(1)                                                  --------->AHL25(1)
      <---------AHL12(1)                                                  --------->AHL20(3)
      --------->AHL12(1)                                                 --------->AHL25(3)
     --------->AHL12(2)                                                 --------->AHL12(3)
     <---------AHL12(2)                                                 <---------AHL12(3)
    --------->AHL12(2)                                                 --------->AHL12(2)
  <---------AHL20(2)                                          <---------AHL12(3)  <---------AHL20(3)
  <---------AHL12(3)                                         --------->ARR11(3)  --------->AHL25(3)
  --------->AHL25(3)                                         <---------AHL20(1) --------->WOX13(2)
  --------->AHL12(3)                                     <------ZmHOX2a(1)--------->AHL12(3)
  --------->AHL25(1)                        --------->DAG2   <---------ARR11(3) --------->AHL12(2)
  <---------AHL25(1)            --------->ARR11(2)     <---------TOE2(3)--------->AHL12(2)        <-
 --------->AHL25(3)             <---------ARR11(2)<---------RVE1(2)  ------->TEIL--------->AHL20(2)
 --------->AHL20(2)       <-----------GT1  ---------->DOF2  <---------KAN1<---------AHL12(3)  <-----
 
acgatataatttattattttgtagaggtattactgtatacaacttataaagttgattttaggaatatatatgtatatttatttatttaattgaggttata  10566900
                                                                   <---------ATHB12
                                                              --------->WOX13(2)
                                                              <---------WOX13(2)
                                                             ------>MYB46(1)
                                                             --------->MYB52(1)
                                                             ------>MYB83
                                                           <---------MYB46(2)
                                                   <------ZmHOX2a(2)
                                     ----------->TBP--------->YAB5 --------->ICU4
                          <---------TOE2(2)       --------->GATA12 <---------YAB1
                          <---------TOE1(2)       <---------ARR11(3)--------->YAB5
                         ------>ZmHOX2a(1)        --------->ARR11(3)<---------ICU4
                         =================================HOX2a_HOX2a--------->WOX13(1)
            <---------ALFIN1         --------->AHL20(2)    <---------MYB59
--------REM1(1)<---------TOE2(2)   <---------HSFB2a(2)   -------->P<---------YAB5
----YAB1  ----------->RAV1(1)      --------->HSFB2a(2)<---------MYB52(2) *TSS                     --
 
gttgtaacttagccaacacaggtttctcctatgttcttctataaatacttgtagatcactaacctaactaatcattcaaacttcaactctcgctaatact  10567000
          <---------ARR14(2)
          --------->ARR14(2)                       <----------DOF2
          <---------ARR11(3)                      <---------DOF5.7(1)
          --------->ARR11(3)                  <-----------GT1
          --------->ARR11(2)                <-----------GT1
          --------->RVE1(2)              --------->WOX13(2)
         --------->CCA1(1)               <---------WOX13(2)
         --------->KAN1              ----------->GT1                              <---------AHL20(2)
         --------->RVE1(1)          <---------HSFB2a(2)                  <---------RVE1(2)        <-
 --------->At4g35610    <---------YAB1<---------MYB52(1)               <---------YAB1    <-------TEIL
-------->DOF2 ------>ZmHOX2a(1)     --------->HSFB2a(2)   --------->RVE1(2)       <---------AHL12(3)
 
tgaaagctcaaaatatcctcttgtattctgatcaaatttctggtaattttctctcttttaatctctaactcattttgattcttatatatatgttcatatt  10567100
                                                                     --------->ANAC46
                                           <-----------GT1           --------->ANAC58
                                        <---------AHL12(2)           --------->ANAC58
                                        --------->AHL12(2)       <-----------GT1
                                        <---------AHL20(3)    <---------AHL12(2)
                                        --------->AHL20(3)   --------->AHL25(1)
                                       <---------ICU4        <---------AHL25(2)
                                      <---------YAB1         <---------AHL20(2)                <----
                                   <---------YAB5            <---------AHL25(1)        <-----------GT1
                                   <---------YAB1            --------->AHL20(3)      <-----------GT1
                                 --------->YAB1              --------->AHL25(2)    <---------AHL20(2)
                               --------->AHL12(2)            <---------AHL20(3)  --------->AHL12(2)
                               <---------AHL12(2)            --------->AHL12(1)  <---------AHL25(2)
                              <---------AHL20(2)             --------->AHL20(2)  <---------AHL12(3)
                       <-----------GT1--------->ICU4        <---------AHL12(1)   --------->AHL12(3)
           <---------WOX13(2)--------->AHL25(3)             --------->AHL12(1)   <---------AHL20(2)
           --------->WOX13(2)--------->AHL20(2)            --------->AHL12(2) ------->TEIL ---------
<---------RVE1(2) <---------MYB52(1)--------->YAB1    <---------ANAC46 --------->AHL20(2)  <--------
--------YAB1    --------->ETT(1)<---------YAB1<----------DOF2<---------AHL12(1) --------->AHL12(2)
 
tctgatttttagccaattgtcggtattttctatttattatcataattttctttttcttcgtgaattttttacaagtaaatgtatattttttctctgttct  10567200
                                   <---------GLK1(2)
                        <---------AHL12(2)
                       <---------AHL25(3)
                       --------->AHL12(1)
                       --------->AHL25(2)
                       <---------AHL12(3)
                       --------->AHL12(3)
                       <---------AHL12(1)                              --------->RVE1(2)
                      --------->AHL12(1)                               --------->ARR11(2)
   <---------AHL20(2) <---------AHL12(1)                      <---------ZAT2
  --------->AHL20(2)  <---------AHL25(2)           --------------->AGL15
 <---------YAB1       --------->AHL25(2)           <---------------AGL15
--------->AHL25(2)    --------->AHL25(1)         <-----------------AG  <---------ARR11(2)
<---------AHL25(2)    --------->AHL25(3)        --------->AHL20(1)     --------->ARR14(2)
--------->AHL20(2)    <---------AHL20(2)        --------->RVE1(2)      <---------ARR14(2)
<---------AHL20(3)    --------->AHL20(2)        --------->ARR11(3)     ------->TEIL
--------->AHL20(3)    <---------AHL20(1)        <---------ARR11(3)    <---------CCA1(2)
-----YAB1         --------->YAB1 --------->ICU4--------->CCA1(1)  <---------ANAC46        --------->GATA12
>ZAT14           <---------ATHB12--------->DOF5.7(1)          --------->ZAT2             <---------CCA1(2)
-ZAT14     --------->YAB5      ---------->DOF2 --------->RVE1(1) <---------DEAR3(1)    ------>ZmHOX2a(1)
 
gaatattatataagtgactaatcaaaaaatttagaaaagattgtttcgaaatatcttatttgggaagctcggtgtatccaaaactctgtcctaaatctct  10567300
                  ---------->ID1
                 <-----------GT1                                                                  --
            <---------AHL12(3)                                                         <---------ANAC58
            <---------AHL20(2)                                                     <---------ANAC58
            <---------AHL25(2)                             --------->ARR11(3)<---------ALFIN1   ----
            --------->AHL25(1)                            <---------KAN1     --------->ANAC58   <---
            --------->AHL12(2)                           --------->GLK1(2)<------NtERF2<---------ANAC58
           <---------AHL12(1)                            --------->ARR14(2)  --------->ANAC58 ------
           --------->AHL12(1)   <---------YAB1           <---------ARR14(2)<---------ALFIN1   ------
         <---------RVE1(2)     <---------ARR11(3)   --------->DOF5.7(1) --------->ANAC46      <-----
   <---------AHL20(2)          --------->ARR11(3) ---------->DOF2   --------->KAN1 <---------ANAC58
 
ctacatttttttgatttttttttcgttttagtaatatcatcgatggtgctatccaaagagaatatgttgaaatactcggcacaccttcgtgcttacaatt  10567400
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
          --------->AtMYB61                                                                       --
   --------->ALFIN1                                                                               <-
  <-------MYC3                                             <---------ARR14(2)                     --
  <-------MYC2                                             --------->RVE1(2)                      --
  ------->MYC3                                             --------->GATA12                       --
  ------->MYC2              <----------DOF2                --------->ARR14(2)                    <--
 <---------KAN1         <---------ARR14(2)            --------->TOE1(3)                          <--
------->LBD16  --------->LBD16  <---------RVE1(2)     --------->TOE2(3)               --------------
------------->AGL1      --------->GATA12     --------->At4g35610         <-----------HVH21      <---
------LBD16   --------->HSFB2a(2)      <---------At4g35610 <---------GATA12           --------------
--->ARR11(2)  <---------HSFB2a(2)      --------->At4g35610<---------CCA1(2)           <-------------
--->ARR14(2)------>MYB46(1) ------>ZmHOX2a(1)<---------At4g35610   --------->KAN1 <---------At4g35610
----ARR14(2)------>MYB83--------->ARR14(2) <-----------RAV1(2)<---------YAB1      --------->At4g35610
 
ccgcatgtggagaccatccagaactcaaatcctttgattctgagcttcagcagaaaacctcaaatctgataaactcgttcacctctgatgccaaaactgg  10567500
<- Previous    Next ->

AGI:  At3g28300.1   
Description:  AT14A. Identical to UPF0496 protein At3g28290/At3g28300 [Arabidopsis Thaliana] (GB:Q9XF11;GB:Q56XE6;GB:Q8GXJ7); similar to AT14A [Arabidopsis thaliana] (TAIR:AT3G28290.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22906.1); contains InterPro domain Protein of unknown function DUF677 (InterPro:IPR007749)
Range:  from: 10566974    to: 10568837    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version