AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                        <-------TEIL
                                       --------->ALFIN1
                                      ------->MYC3
                                      <-------MYC3
                                      <-------MYC2
                             --------->YAB5
                             --------->KAN1                                      --------->HSFB2a(2)
                             <---------ICU4                            --------->AHL20(2)
                             <--------ATHB1                            ---------->DOF2             -
                            <---------KAN1                       ----------->RAV1(1)               -
                      ----------->GT1 ------->MYC2              <---------ETT(1) <---------HSFB2a(2)
              --------->YAB1--------->AHL12(1)                  --------->At1g77200               --
         <---------YAB1     <---------AHL25(1)                  --------->DREB2C(2)               --
--------->RVE1(2)     <---------ANAC55(2)<---------AtLEC2       --------->DEAR4(1)     ------->GAMYB
--------GT1  <-------TEIL   <---------AHL12(1)  <---------KAN1  --------->DEAR3(1)    --------->ANAC46
 
cacaatccaaatgtgattcatagtcaagtgaataattccaacgtgcagggcatcacccataaaaacaccgacaataaaacacttccacaacgacactgat  10562400
             ------>ZmHOX2a(1)
       <---------DOF5.7(1)
       <---------DAG2
       <----------DOF2                                      <---------GLK1(1)
  ------>MYB83                                              --------->GLK1(1)
  ------>MYB46(1)                                          --------->GATA12
 --------->ANAC46                                          --------->ARR11(3)
<---------MYB55(2)                                         <---------ARR11(3)
--------->MYB46(3)                                       <---------TOE2(3)
-------->ANAC58          <----------DOF2            --------->RVE1(2)       --------->DOF5.7(1)
-------->ANAC58    ----------->GT1               ---------->DOF2          ---------->DOF2
------->PCF2 --------->LBD16                  ----------->RAV1(1) <---------MYB52(1)
----->TEIL <---------LBD16                   --------->MYB46(3)  <----------DOF2          <---------DOF5.7(1)
 
gcacccactacttttcctgaaattgtgactttcgcgactctattttcaacaacaaagtctaagatttcctttagccaaaaagacccatgggtctcttatg  10562500
                                                                    <---------ATERF1(1)
                                                                <---------ANAC46
                                                                --------->DEAR3(1)
                                                               <------NtERF2
                                                               --------->ATERF1(1)
                                                              ------>NtERF2
                                                             --------->DEAR3(1)
                                                            --------->DEAR4(2)
                                                            <---------ABI4(2)
                                                            <------NtERF2
                                                            <---------At4g35610
                                                            --------->At4g35610
                                                            --------->ATERF1(1)
                                                          <---------DEAR3(1)
                                                         --------->At4g35610
                                                  ------>NtERF2<---------LBD16                  ----
         <---------ANAC58                        --------->ANAC46  --------->ARR14(2) --------->KAN1
         <---------ANAC58                        --------->RAP2.6(2)--------->KAN1 ----------->GT1
        <---------At4g35610                      --------->ANAC58 <------NtERF2   ----------->GT1
        --------->At4g35610                      --------->ANAC58--------->LBD16 ----------->GT1<---
    --------->GLK1(2)                         --------->DOF5.7(1)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
<------ZmHOX2a(1)------>NtERF2            <------ZmHOX2a(1)<---------ATERF1(1) --------->ALFIN1 <---
 
ggaggagagtctgcttgcgacgactgagttggagagggaagagaaggagaagacgccatcggcagcgccggagactccatcggagggggaaaatcgctac  10562600
                                                                                           <--------
                                                                            --------->AHL12(2)
                                                                            <---------AHL12(2)
                                                                            --------->AHL25(2)
                                                                            --------->AHL20(3)   <xx
                                                                            <---------AHL20(3) -----
----->TOE2(3)                       <---------YAB1                         --------->AHL12(1) ------
------MYB59                       --------->KAN1          --------->YAB1  <---------KAN1   ---------
------------AGL15            <---------TOE2(3)  --------->TOE2(3)  <----------DOF2 <-----------GT1 x
 
cttacaagggatgctagacgatgggagcgactagggtttatgcttcaaaaaacttaaactttcatatttcctttgggataattttaaaaccttctatccg  10562700
                               --------->ARR11(3)
                               <---------ARR11(3)
                     --------->GLK1(1)
                  <---------MYB52(1)
                 --------->LBD16                                                                   -
                <---------ANAC55(2)                                                                <
                <---------ANAC46                                                                  <-
      <---------RVE1(2)     --------->HSFB2a(2)                                       <---------AHL20(2)
  ----------->GT1<---------RAP2.6(3)                                                 --------->AHL20(2)
-ARR11(2)       <---------ANAC58--------->GLK1(1)                                  <---------WOX13(2)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                                            ----------->GT1     --
---->LBD16      <---------ANAC58<---------GLK1(1)                          --------->ARR14(2)     <-
--->ANAC46      --------->ANAC55(2)                                        <---------ARR14(2)   ----
>ARR11(2)       <---------ANAC55(1)                                 <---------YAB5 --------->WOX13(2)
xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <---------MYB59   <---------WOX13(2) <---------KAN1      ------
 
aaatagagtgatatagatgccgtgatttcttcaagaactccctaacttcttcttggtaaactgaacaagtagtcagagtatttgtaaatttaaaagtttt  10562800
       --------->ANAC58
       ----------->HVH21
       --------->ANAC46
       --------->ANAC58
      --------->SPL7(1)
   <------MYB83
   <------MYB46(1)                                         <---------ATHB12
  <---------------AtSPL8                               <---------KAN1
  <---------------AtSPL3                            <----------ID1           <---------At4g35610
 <---------WOX13(1)                               <---------------AtSPL8     --------->At4g35610
<------------CBF                                  --------->DOF5.7(1)        <---------ZAT2
-------->ATHB12                                 ---------->DOF2          <-----------HVH21
---------ICU4           --------->ANAC58     ------>ZmHOX2a(1)       <---------ANAC58
--------YAB5    *TSS    --------->ANAC58     --------->LBD16--------->YAB1 <---------WRKY38(1)  ----
------->ICU4  <---------At4g35610           --------------->AGL15    <---------AtLEC2           <---
--------YAB1  --------->At4g35610          ----------->RAV1(2)       <---------ANAC58           <---
----->YAB1<---------ALFIN1                 <-----------------AGL1<----------DOF2--------->At4g35610
----------------->TaNAC69(2) <---------YAB5--------->At4g35610   ------>ZmHOX2a(1)             -----
 
catgattggtacgacactgctgaactcaaggaagcattagtaagtctcctgaaaaggaacaaatcatcctttgcctggtcagcagaagacatgtctagca  10562900
                                                                                              ------
                                                                                             -------
                                                                                          --------->ANAC58
        --------->AHL25(3)                                                                --------->ANAC46
        <---------YAB1                               ----------->GT1                 --------->ZAT18
      --------->YAB1                                 --------->ANAC58             --------->DOF5.7(1)
----->At4g35610                                      --------->ANAC58   <---------LBD16   --------->ANAC58
------At4g35610                             --------->ANAC58         <---------ZAT2  <---------ZAT18
------KAN1          ----------->GT1         --------->ANAC58 <----------ID1     ---------->DOF2    -
---->GATA12   <-----------HVH21 <---------WOX13(2) ---------->DOF2---------->DOF2--------->DOF5.7(1)
 
tctgcccaagtataatttgtcacgagttaaatgtcaacttaagtttcaagcatgtaaagcaaaaacgaagaaagctcgggacagaaagggcacaagcagt  10563000
                                                                   --------->GLK1(2)
                                                           <---------ANAC58
                                                           <------MYB83
                                                           <------MYB46(1)
                                                          --------->MYB55(2)
                                                          <---------MYB46(3)
                                                     --------->LBD16
                                                 --------->ARR11(2)<---------GATA12
                                                 <---------ARR14(2)--------->GATA12
                                                 <---------ARR11(2)--------->ARR14(2)              <
                                    --------->DOF5.7(1)  <---------ANAC46<--------P                =
                              <-------TEIL       --------->RVE1(2) <---------ARR14(2)              =
                           <------MYB83          --------->GLK1(2)--------->WOX13(1)           <----
--------->YAB5             <------MYB46(1)       --------->ARR14(2)<---------ARR11(2)          -----
--->At5g28300             --------->MYB59       --------->KAN1 <------NtERF2             --------->DOF5.7(1)
---->GT1----------->GT1 --------->ARR14(2)    xxxxxxxxxxxxxxxx>smallRNA(i)           ----------->GT1
---------->TGA1         <---------ARR14(2)  --------->ZAT18<---------ANAC58 <---------YAB5     <----
 
aaatgacgaagtggataaacttctgaagataggttcaataagagaagtccagtatccgtagtgggtggccaatctggttgtcatcaagaagaaaaatgga  10563100
                                    <---------ANAC58
                                    <---------ANAC58
                                 --------->DAG2
                                 --------->DOF5.7(1)
                                --------->DOF5.7(1)
                                ---------->DOF2                                                 <---
                          ============================HOX2a_HOX2a                               <---
                         <------ZmHOX2a(2)                                                   <------
                         =============================HOX2a_HOX2a                            <------
                        --------->AGP1                                                    --------->AHL25(2)
           <-----------GT1------>ZmHOX2a(2)                                              --------->YAB1
        ----------------------->TaNAC69(2)                                 ------>MYB46(1)--------->AHL20(3)
    <---------ANAC58    <---------AGP1                                     ------>MYB83  <---------ICU4
    <---------ANAC46    --------->GATA12                                  --------->ORA47(1)--------
    <---------ANAC58    <---------GATA12                   <---------ARR14(2)          <---------AHL12(2)
<---------ARR11(2)      --------->ARR11(2)                 --------->ARR14(2)          --------->AHL12(2)
--------->ARR14(2)      <---------ARR11(3)                 --------->ARR11(2)        --------->AHL20(2)
--------->ARR11(2)      --------->ARR11(3)                 <---------ARR11(2)        --------->AHL25(3)
<---------RVE1(2)       <---------ARR11(2)              <---------ANAC58 ------->GAMYB<---------AHL20(2)
<---------ARR14(2)      <---------ARR14(2)          <----------DOF2      --------->DEAR3(1)<--------
------ZmHOX2a(1)        --------->RVE1(2)          <---------ANAC58     --------->DEAR3(2)<---------AHL25(2)
================================HOX2a_HOX2a        <---------ANAC58   --------->MYB52(1)<---------YAB1
=================================HOX2a_HOX2a   <------ZmHOX2a(1)      <-----------GT1--------->ICU4
-----ARR11(2)           --------->ARR14(2) ---------->DOF2<---------MYB52(1)   <---------TOE2(3)----
---->ARR11(2)          <---------CCA1(2)   --------->MYB52(1)     <---------KAN1 <---------ARR11(3)
-----RVE1(2)       <-----------GT1--------->DOF5.7(1)   <---------ANAC58--------->MYB46(3)<---------AHL20(3)
 
taggatagggtgtttatcgatttcacagatctaaaaaaagcgtgcctaaaggatgctttccgttttcgcatattaaccgaccaaggtatttattattata  10563200
        --------->RAP2.6(3)
       --------->ARR11(2)
       <---------ARR11(2)
     <----------DOF2
     <---------DAG2
  --------->ANAC58                                                          --------->DOF5.7(1)
  --------->ANAC58                                                   --------->TOE2(3)
--------->MYB52(1)                                                  --------->ANAC46
<---------DOF5.7(2)                                               --------->ANAC46
------TOE2(3)                                                     <---------ALFIN1
------TOE1(3)                                                   --------->ANAC46
---AHL20(2)                                                     <---------ALFIN1
---AHL20(3)    ---------->DOF2                      --------->DOF5.7(1)   ---------->DOF2
->YAB1<----------DOF2                        ----------->GT1    --------->ANAC58              ------
-YAB1<---------DOF5.7(1)                     <------MYB46(1)    --------->ANAC58        --------->ALFIN1
----->DAG2   <----------DOF2                 <------MYB83     <---------ALFIN1         <------------
 
aggtaacgcctttcggcttaaagaatgcagaagtaacttatcaacgcttggtgaaaaaatgttccacacacacctcaaaaagacaatggaggtgtacatg  10563300
<- Previous    Next ->

AGI:  At3g28295.1   
Description:  transposable element gene. gypsy-like retrotransposon family, has a 6.4e-29 P-value blast match to aF23C08 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family)
Range:  from: 10562817    to: 10563326    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version