AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       <---------HSFB2a(2)
      <---------TOE2(1)
      <---------TOE1(1)
   <---------SPL7(1)
------->DOF5.7(1)         <---------DOF5.7(2)                                               --------
------->DAG2             <---------ARR11(2)                                      --------->TOE1(2)
------>DOF5.7(1)         --------->ARR11(2)                                     <---------ANAC58
------>DOF2             --------->At5g28300          --------->GATA12           <---------ANAC58
--------AGL15           --------->DOF5.7(2)          <---------GATA12           --------->MYB52(2)
->TOE1(3)       <---------MYB46(3)          --------->ICU4           --------->WOX13(2)     --------
------->AGL15 <---------ANAC58          <---------SPL7(1)            <---------WOX13(2)     --------
->TOE2(3)     <---------ANAC46        <---------------AtSPL3     --------->AHL12(2)     <---------KAN1
-------->AGL2 <---------ANAC58     <---------AtMYB61 --------->ARR14(2)   --------->At4g35610
---------AGL1<-----------------------TaNAC69(2)      <---------ARR14(2)   <---------At4g35610      -
 
aaaggcagtccgagatggcttgttgacggtaacgtttggaggtcgtactgatgtccaatctggctgaaaattagttgagctgttcgtgggaatacaggct  10551800
                                                        --------->HSFB2a(2)
                                                        <---------HSFB2a(2)
                                                  <---------ANAC46
                                                  <---------ANAC58
                                            <---------YAB1
                                           --------->AHL12(2)                               ------>ZmHOX2a(2)
                                           <---------AHL12(2)                              <------ZmHOX2a(2)
                                          <---------AHL20(2)                              --------->AGP1
                                          <---------AHL12(3)                              --------->ARR11(3)
                                          --------->AHL12(3)                              <---------ARR11(3)
                                          <---------AHL25(3)                              <---------AGP1
                                          <---------AHL25(1)                              --------->RVE1(2)
                                          --------->AHL25(1)                              --------->GATA12
                                         --------->AHL12(1)                         --------->YAB1
                             <---------MYB52(1) <-----------GT1                     --------->YAB5
                 ----------->GT1         <---------AHL20(2)                        <---------YAB1
              --------->GLK1(2)          --------->AHL25(3)                      <---------ICU4
             <---------RVE1(2)           <---------AHL12(1)                      --------->YAB1
->ANAC46     <---------GLK1(1)           --------->AHL20(2)                     --------->ICU4<-----
->ANAC58     <---------GLK1(2)          <---------WOX13(1)                      <---------ATHB51
->ANAC58     <---------ARR14(2)      <---------YAB1  <---------ARR11(2)        <---------WOX13(2)---
-------->KAN1--------->ARR14(2)--------->MYB52(2) <---------ANAC58  <---------RVE1(2)     <---------GATA12
 
acatattcaatggtgggattctgttataaacagttagtttctgatttatttttgcgtttctaaaaatgtttgatatagagcaaattatgataagatctat  10551900
                                                               <---------AHL25(2)
                                                               <---------AHL20(3)
                                                               --------->AHL20(3)
                                                              --------->AHL12(1)
                                                              <---------AHL12(1)
                                                           --------->ATHB12
                                                           <--------ATHB1
          <---------WOX13(2)                               --------->YAB5
     <------MYB46(1)                                       --------->YAB1
     ----------->GT1                                       <---------ICU4
     <------MYB83                                 --------->ARR14(2)
    --------->MYB111(2)                           --------->ARR11(2)
    --------->MYB111(1)                        --------->ANAC55(2)
    <---------MYB46(3)                         --------->ANAC55(1)
    --------->MYB46(2)                         --------->ANAC58--------->AHL25(2)
   <---------MYB55(1)                          --------->ANAC46<---------AHL12(2)
   <--------P                             --------->YAB1  <---------YAB5
  <-------GAMYB                           <---------ICU4  --------->ICU4
 <------MYB46(1)                         --------->ICU4   <---------ATHB12
 <------MYB83                       ----------->GT1   ------------>CBF
 <---------MYB46(3)     --------->At4g35610    <---------ANAC55(2)
<---------AtMYB61       <---------At4g35610    --------->ANAC58--------->AHL12(2)          <--------
--------->MYB59         --------->ZAT2  <---------RVE1(2) <---------YAB1                   <--------
-------CBF--------->WOX13(2)    --------->ALFIN1  <---------ARR11(2)                   <------------CBF
------>ATHB12 ------->TEIL----------->HVH21   <---------LBD16<---------YAB1<---------KAN1  <--------
 
tgtttggttggtaaatgaacttggatgagctgaaggtgagggtgataatcacggaaacacaatgattattttctaagcatgttcttcatgaattgcttgt  10552000
                                            --------->ALFIN1
                                          <---------ANAC46                                       ---
                                      <---------RVE1(2)                                     <-------
                                  <------------CBF            --------->CCA1(2)        ----------->TBP
                         --------------->AtSPL8            <---------YAB1            <-----------TBP
-ANAC58             <---------ANAC46 --------->YAB1      --------->YAB5              --------->AHL20(2)
-ANAC46        ------->TEIL    <----------DOF2----------->HVH21              <------ZmHOX2a(1)  ----
-ANAC58    --------------->AtSPL8--------->ATHB12 <------------CBF ----------->GT1 <----------DOF2 <
 
ataggtttggaaactatgtacttgtttgtatgttctttattgatagtgtgtgacattgaacgatgatatgatgtaatataggaagactttatatataaca  10552100
                                                              <---------ANAC46
                                                       --------->YAB1
                                                       <---------ANAC58
                                                       <---------ANAC58
                                                     --------->ARR11(2)
                                                     <---------ARR14(2)
                                                  <---------ANAC46
                                           <------MYB83<---------ANAC46              ------->TEIL<--
                                           <------MYB46(1)   <---------MYB46(3)   <---------ANAC58
                                 --------->ARR14(2)  <---------ARR11(2)           <---------ANAC46
                                 <---------ARR14(2)  --------->ARR14(2)           <---------ANAC58 <
                                 ------->TEIL     <---------ANAC55(2)        <------MYB83        <--
                              --------->ANAC58    <---------ANAC58  ----------->RAV1(2)    ---------
------>YAB5                   --------->ANAC58    <---------ANAC58 ------->TEIL  --------------->AtSPL3
----GT1<----------DOF2     <---------SPL7(1)      --------->ANAC55(2)--------->TOE2(2)     <--------
----->ICU4         --------->ALFIN1--------->TOE1(2)<---------CCA1(2)--------->TOE1(2) <---------LBD16
---------YAB1      <-----------RAV1(1)  <------------CBF    <---------ANAC46 <------MYB46(1)  <-----
 
tgatgatatactttgagttaatgtgttggggctacggacctgagattggttttgcgtatcgtgatgggtgaacctgagattggtttcgtacctggatgtg  10552200
               <---------AHL12(3)
               --------->AHL25(1)
               --------->AHL12(2)
               <---------AHL25(2)
               <---------AHL20(2)
              --------->AHL12(1)
              <---------AHL12(1)
              --------->AHL25(3)
             <---------CCA1(1)
             <---------RVE1(1)
            --------->ARR11(3)
            <---------ARR11(3)                                                                  ----
      ----------->RAV1(2)                                                                       <---
     ------->TEIL                                                                             ------
  --------->ANAC58                                                                         ---------
  --------->ANAC58                               <------MYB46(1)                           ---------
-------------AtSPL3                              <------MYB83   <---------MYB46(3)         ---------
---------SPL7(1)                               <---------WOX13(1) <---------WOX13(1)     --------->KAN1
-------------AtSPL8                     <---------ANAC58        --------->ATHB12         <---------ANAC58
>GATA12--------->TOE2(2)            <---------ANAC58           <---------YAB1            <---------ANAC58
-GATA12--------->TOE1(2)<---------AtLEC2<---------ANAC58     <---------At4g35610    <------MYB46(1)
----YAB1    <---------RVE1(2)       <---------ANAC58       <---------ANAC46         <------MYB83----
 
attgtacgaacctgagattttttttgtgcatggtaatgggcgagcgtgagattggtattgtgtctggtgattggacgagcttgagattggtttcatgcca  10552300
                                                      <---------AHL12(3)
                                                      <---------AHL12(2)
                                                      --------->AHL25(2)
                                                      --------->AHL12(3)
                                                     <---------AHL25(2)
                                                     --------->ARR11(3)
                                                     --------->AHL25(2)
                                                     --------->AHL12(1)
                                                     <---------AHL12(1)
                                                     --------->AHL12(2)
     --------->At4g35610                             <---------ARR11(3)
    --------->DEAR3(1)                               <---------AHL20(3)
  ------>NtERF2                                      --------->AHL20(1)                       ------
 --------->ANAC46                                    <---------AHL20(1)                      -------
--------->ZAT14                                      --------->AHL20(3)           <---------YAB1
<---------ZAT14                                     --------->AHL12(1)            <---------KAN1
----->ANAC46                                   <---------WOX13(1)                <---------TOE2(2)
------ALFIN1                                 --------->ATHB12                    <---------TOE1(2)
----->RAV1(1)                                --------->YAB5                      ------->TEIL<------
>ANAC46                                     <---------YAB1                    <---------ANAC55(2)
>ANAC58                                  <---------AHL20(2)                   --------->ANAC55(2)  -
>ANAC58                     <---------YAB1  <---------YAB5          <-----------RAV1(1)      <------
----->ZAT6             <---------ZAT6  ------->TEIL <---------AHL12(1) ----------->GT1       -------
 
cactacgccgatgaaatttctatttagcgttattgttgaatgaatttatgattgaatatttttaaaaacttatgttgttatacgtatgtttgagaacgtg  10552400
                                 --------->YAB5                      <----------DOF2
                                <---------YAB1                      <---------DOF5.7(1)
    ------>ZmHOX2a(1)       <---------ANAC46                      <-----------GT1
--->ALFIN1                  <---------ANAC58                     <-----------GT1
>MYC3                  <---------MYB46(3)                     <---------DOF5.7(1)         <---------
-MYC2                 <---------WOX13(1) <---------KAN1      <----------DOF2              <---------DAG2
-------->ATERF1(1)  --------->ATHB12   <---------GLK1(2)    <---------DOF5.7(1) <---------ANAC58  <-
-MYC3              --------->ICU4--------->ATHB12      <---------ZAT18          <---------ANAC58  --
>MYC2    --------->AtLEC2   <---------ANAC58           --------->ZAT18      <---------MYB52(1)    <-
 
gagtctccttccatgctatgcattgattgttgagtgtgattagaatttcgccattgtgttcgctctttttatcttttcccttagcttgataagctttatg  10552500
                                        <----------DOF2
                                        <---------DOF5.7(1)
                                       <---------DAG2         --------->DOF5.7(1)
                                       <---------DOF5.7(1)   --------->DAG2                       --
                                <---------DOF5.7(1)          --------->DOF5.7(1)          <---------ANAC58
-DOF2                         ------>ZmHOX2a(2)             --------->DOF5.7(1)           <---------ANAC58
--------RVE1(2)             --------->GATA12                ---------->DOF2    <<<<<<<<<TBF1   <----
------->GATA12              --------->ARR11(3)  --------------->AGL15    --------->KAN1  -----------
--------GATA12  <---------RVE1(2)<----------DOF2--------->TOE2(3)      <-----------GT1   -----------
 
agatgtggttttcttagtcgattttggttttgatctcttttgccttttctaccttgatgagcaaaaaggaagttttacattcttcttcttatttcgtact  10552600
                --------->WOX13(2)
             ------>ZmHOX2a(2)
           <---------ARR11(2)
           --------->ARR14(2)
           <---------ARR14(2)
           --------->ARR11(2)
           <---------GATA12                                                ---------->DOF2
        <---------TOE2(3)                                                <---------YAB1
 ===================HOX2a_HOX2a                                     <---------DOF5.7(1)
 ==================HOX2a_HOX2a                                      <----------DOF2              <--
 ------>ZmHOX2a(1)                                       --------->DOF5.7(1)                    <---
-------->ID1<------ZmHOX2a(2)                           --------->MYB52(1)--------->YAB1        <---
-----YAB5 <------ZmHOX2a(1)                            <---------KAN1<---------DOF5.7(1)    <-------
---->AtSPL8--------->GATA12                      ---------->DOF2   <---------DAG2      --------->HSFB2a(1)
---->AtSPL3--------->RVE1(2)  --------->KAN1    <---------ATHB12<-----------GT1       ------->TEIL
 
cgtccttatataaggatccaattggggtttgcaatattcagtttttgatcaataaagaataagggttttaccttttatcaaagtctacgaacttcctttg  10552700
<- Previous    Next ->

AGI:  At3g28291.1   
Description:  unknown protein
Range:  from: 10552164    to: 10552343    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version