AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           --------->ARR11(3)                              <-------GAMYB
-----TEIL  <---------ARR11(3)    --------->ANAC46   <---------ANAC55(2)
-----RVE1(2)                  <---------ZAT18       --------->ANAC55(2)
-----GLK1(2)              <---------ICU4       --------------->AGL15
---->ARR14(2)            <---------YAB1        --------->YAB5                              ---------
-----ARR14(2)           --------->TOE2(3)<---------ICU4   <---------MYB46(3)    --------->YAB1
---->ARR11(2)       --------->YAB1       --------->YAB5  <---------YAB1       <---------ARR11(3)
-----ARR11(2)      <---------ATHB12     <---------YAB1   <---------AtMYB61    --------->ARR11(3)----
--->KAN1   --------->ARR14(3)--------->AtLEC2 <---------YAB1             --------->ZAT14   <--------
 
ttcgttcaaaacaaggtctccaaacatcatcaatgcacaaaacatcattaccattaagtgatggttgagtttgaactgaactatcttcatacttccataa  10288600
              -------->ATHB1
              <--------ATHB1
              <------------ATHB5
              --------->ATHB12
              <---------ICU4
              --------->ATHB51                                         ---------->DOF2
              --------->YAB1                              <---------AHL25(1)
              --------->YAB5                              --------->AHL20(2)
             <---------ATHB12                             --------->AHL25(1)
             <---------YAB5                             <---------WOX13(2)        --------->GLK1(1)
   ---------->DOF2                             --------->ZAT6         --------->YAB1
>HSFB2a(2)   <---------YAB1                  <-----------GT1         <---------YAB5
----->ZAT6   --------->ICU4<-----------GT1----------->GT1<---------ATHB12    ----------->GT1
-HSFB2a(2) --------->WOX13(1)    ---------->DOF2        --------->WOX13(2)<---------ZAT2   ---------
 
gactaataaagaaacaatcattggaactattacccatatagcacatagtaacactctccaattaaaccagtaatcaaagctggtgaattccaaaacattc  10288700
                                                          --------->ARR14(2)
                                                          <---------GATA12
                                                          <---------ARR14(2)
                                                          --------->ARR11(2)
                                                          --------->AGP1
                                                          <---------ARR11(2)
                                                    <----------DOF2
                                                   ------>ZmHOX2a(2)
                                                  <---------RVE1(1)
                                                 <---------ARR14(2)
                                                 <---------GATA12
                                                 <---------ARR11(2)
                                                 <---------RVE1(2)
                                                 --------->ARR11(2)
                                                 <---------ARR11(3)
                                                 --------->ARR14(2)
                                             <---------LBD16
                                           <---------ARR14(2) --------->LBD16
                                           --------->ARR14(2)--------->ANAC46
                                           --------->KAN4(2)------>ZmHOX2a(2)
                <---------ANAC58          --------->KAN4(1)<------ZmHOX2a(2)
              <-----------GT1             <---------KAN1  --------->GATA12
        <---------AHL20(2)                <---------KAN4(1)--------->CCA1(2)
        --------->AHL25(2)     --------->GATA12  <---------ARR11(1)
        --------->AHL12(3)     <---------RVE1(2)<---------CCA1(2)                   --------->LBD16
        --------->AHL25(1)     <---------GATA12 <---------ARR14(1)                <---------LBD16
        <---------AHL25(2)     <---------ARR11(2)--------->ARR11(3)              --------->MYB52(1)
   <---------YAB5   ---------->ID1        --------->KAN1  <---------RVE1(2)     <---------ALFIN1
   <-------TEIL <---------ANAC58 ------>ZmHOX2a(2)<------ZmHOX2a(2)         <------ZmHOX2a(2)
>KAN1  <---------DOF5.7(1)     --------->ARR11(2)--------->GATA12          --------->GATA12
 
tcaagattcattttttttttcttgttctcttgttgatccgtctgaatattcggatcttttagatccgaaactcaatgggatcaacaccggacttgaaaac  10288800
                                                                     <---------YAB1
                            ---------->DOF2                          <---------TOE1(3)
                <---------ZAT14                                      <---------TOE2(3)
 <------ZmHOX2a(2)     ----------->GT1      <---------WOX13(1)  <---------ZAT6
 ============================HOX2a_HOX2a   <---------RVE1(2)<---------YAB1                         <
<---------GATA12--------->ZAT14   --------->At4g35610    <---------ARR11(3)                        -
--------->RVE1(2)     <------ZmHOX2a(1)   --------->ATHB12--------->CCA1(2)                   <-----
--------->AGP1  <---------At4g35610     <---------WOX13(1)--------->KAN1                    <-------
<---------ARR11(3) <---------At4g35610 --------->WOX13(2)--------->ARR11(3)          <---------RVE1(2)
--------->GATA12--------->At4g35610    <---------WOX13(2)<---------RVE1(2)       <----------DOF2  <-
 
ccagatcaaaaactgtctctgcagaggagttaaaagtagcttaattgatttacatatagagatattagtgttaagattaagtagctttgattcttgatac  10288900
                                                                                                  --
                                                                                                ----
                                                                                               <----
                                                                                         --------->KAN1
    <---------YAB1                                                                       --------->CCA1(2)
 <---------MYB52(1)            ------>ZmHOX2a(1)                                        --------->ARR11(3)
---------ANAC55(2)          ---------->ID1                 ----------->GT1              <---------ARR11(3)
-------->ANAC55(2)      <---------ANAC58          ----------->HVH21            <------MYB46(1) -----
----ICU4                <---------ANAC58      <---------ANAC46                 <------MYB83    <----
--RVE1(2)              <---------HSFC1(2)     <---------ANAC58   --------->WOX13(2)     <---------RVE1(2)
--------TOE2(3)        --------->HSFC1(2)     <---------ANAC58   <---------WOX13(2)   ----------->ARR10
 
ttacgttatgttaagagaaatgtagaagcttgtccttgttcttgttgttgtgtgtgatggagaagtcaaattgaaacttggaaggtgatgagatatgaga  10289000
                                                                                    <---------HSFC1(2)
                                                                                    --------->HSFC1(2)
                                                                                    --------->HSFB2a(1)
                                                                                    <---------HSFB2a(1)
                                                                                  <---------PCF2
                                        <---------ALFIN1                     <---------O2
                             ----------->HVH21                               --------->O2
                            <------NtERF2                                    <---------ZAT2
                          <---------DEAR3(1)                                 <---------TGA1a
           *TSS    ------------>CBF    --------->ZAT18                       --------->ZAT2
     <---------GATA12     <---------DREB2C(2)                                --------->TGA1a
     --------->GATA12     <---------ANAC46                                 <-----------RAV1(2)
--------->GT1    --------->RVE1(2)   --------->PCF2                      <------ZmHOX2a(1)
----->CCA1(2)  <---------KAN1--------->ALFIN1                          --------->ANAC58
-----RVE1(2)   <---------KAN4(1)  --------->At4g35610             <----------ARF1 --------->TCP15(1)
---->ARR11(3)  --------->KAN4(1)  <---------At4g35610          --------->ALFIN1--------->ALFIN1
-----ARR11(3) ------------>CBF<-----------HVH21        <---------ZAT14 --------->ANAC58      <------
 
tatgtataaatctgaagaacaatccaatggcggtgtcagaggcccactggaatcggagaacacagagtggagacaaggacaggtgggaccttctccgttt  10289100
                                                                                          --------->RVE1(2)
                                                                                          --------->ARR11(3)
                                                                                          <---------ARR11(3)
                                                                                         <---------GLK1(1)
                                                                                         <---------CCA1(1)
                                                                                         --------->GLK1(1)
                                                                                         --------->CCA1(1)
                                                 --------->AHL20(2)                      <---------RVE1(1)
                                    <---------ANAC46                                     --------->RVE1(1)
                                  <---------ANAC58                           <---------AHL20(2)
                             <------MYB46(1)    <---------------AGL15        --------->AHL20(2)  ---
                         <---------RVE1(2)      ===========================================MADS_MADS
                         <---------GATA12       --------------->AGL15      <---------------AGL15 ---
                    --------->O2  <---------ANAC55(1)                     <-----------------AGL3 ---
                    <---------O2  <---------ANAC46 --------->WOX13(2)     ==========================
        --------->WOX13(2)   <------MYB83      <-----------------AGL1<---------GATA12   --------->ARR11(3)
       --------->MYB52(2)--------->GATA12    <-----------GT1  --------->RVE1(2)     ---------->DOF2
---MYB52(1)    --------->MYB52(1) <---------ANAC58 <---------WOX13(2)--------->RVE1(2)  <---------ARR11(3)
 
gtccaacgcttagttgccaaacgacgtcgatttggtttcgtgtgtattttacttaaataggcctaaatcacaaatctcatataaatggaaagatatctac  10289200
         <---------AHL12(2)
         <---------YAB1
        <---------AHL20(1)
        --------->AHL12(2)
        --------->AHL12(3)
        <---------AHL20(2)
        <---------AHL25(2)
        --------->AHL25(2)
        --------->AHL20(3)
        <---------AHL20(3)
       --------->AHL12(1)
      --------->AHL25(3)
      <---------YAB1
     --------->AHL12(2)
     <---------AHL25(2)
     --------->AHL25(2)
     --------->AHL20(3)
     <---------AHL20(3)
    <--------HAHB4
    <---------ICU4
    --------->YAB1
    --------->ATHB51
   <---------YAB1        <---------WOX13(2)                               --------->ZAT18
   --------->ICU4        --------->WOX13(2)             <---------DOF5.7(1)            --------->YAB1
------>ANAC58    --------------->AGL15                 <----------DOF2<---------ARR14(2)         ---
------>ANAC58    <---------------AGL15               ---------->ID1   --------->ARR14(2)      ------
------>ANAC46 <-----------GT1 --------->ZAT6        <-----------GT1  <------ZmHOX2a(1)<---------KAN1
=================================MADS_MADS  <---------TOE2(3)<-----------RAV1(1)---------->DOF2 <---
 
aagcccattattatttttaactatttgtagttaagactaaaattgttaagttttttttctttttttgttggaggaattgcacaaaaagaataagaagtaa  10289300
                                                                 <---------ARR11(3)
                                                                 <---------ARR11(2)
                                                           ------->TEIL
                    ------>ZmHOX2a(2)                    --------->YAB5
                   <------ZmHOX2a(2)                   <---------TOE2(3)
                  <---------GATA12                    --------->YAB1
                  --------->GATA12                  <---------YAB1              --------->ANAC55(2)
                  --------->RVE1(2)                --------->TOE2(3)   ---------->DOF2             <
                  <---------AGP1                  --------->YAB5 <---------GATA12                  <
           <------MYB83 --------->WOX13(2)       <---------YAB1  --------->ARR11(2)                <
           ----------->GT1                      --------->ARR11(3) ------>ZmHOX2a(2)              --
-------->GT1      --------->ARR11(3)            <---------ARR11(3)<------ZmHOX2a(2)       <---------
--->MYB52(1)      <---------ARR11(3)           --------->RVE1(1) --------->ARR11(3)   <<<<<<<<<<GT-3b
------YAB5 <------MYB46(1) <-----------GT1     --------->CCA1(1) --------->GATA12  ------->TEIL-----
 
tggtttattgtatttggttaagatctcaattttctatgtagttagtcaaaatatcattaatgaatatagatcccaaaagttttatgtatttttcttttag  10289400
                                                 <---------AHL20(2)
                                                --------->AHL25(2)
                                                <---------AHL25(3)
                                                <---------AHL25(2)           --------->AHL12(2)
                                                <---------AHL20(3)      <---------ANAC55(2)
                                                <---------AHL25(1)      <---------ANAC58
       <---------DAG2                           <---------AHL20(2)      <---------ANAC46
---------ANAC46                                 --------->AHL20(3)      <---------ANAC58
---------YAB1                                   --------->AHL20(2)      <---------ANAC55(1)
---------ANAC55(2)  <---------RVE1(2)           <---------AHL20(1)      --------->ANAC55(2)
------->MYB59   ----------->GT1         >>>>>>>>>MYB2              --------->YAB5
-DOF2  <----------DOF2   --------->ANAC46       --------->AHL20(1)<---------YAB1
---->WOX13(2)   --------->YAB1  --------->MYB52(1)        --------->ANAC46 <---------DOF5.7(1)
 
ttatgtatgacttttcgaatggtgatatacaaaacaaatggaaaaccaaaatataatgtatacaaaactctcattacgtttttttttgtttgtgttttgc  10289500
<- Previous    Next ->

AGI:  At3g27770.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G62960.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO14740.1)
Range:  from: 10286894    to: 10289012    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version