AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                       --------->DOF5.7(1)
                                     ---------->DOF2
                                   ------>ZmHOX2a(2)
                                  <------ZmHOX2a(2)
                                  --------->CCA1(2)
                                 >>>>>>>>>GATA-1
                                 <---------ARR11(3)
        --------->ANAC58         >>>>>>>>>GATA-4
        --------->ANAC58         --------->ARR11(3)
       ------->GAMYB             >>>>>>>>>GATA-3
      --------->MYB46(3)         --------->AGP1                 ------------------------>ANAC81
 --------->TOE2(3)               >>>>>>>>>GATA-2              ------>MYB83  <---------AHL20(2)
 --------->TOE1(3)               --------->GATA12             ------>MYB46(1)
--------->YAB5                   <---------GATA12     <---------YAB1  --------->YAB1
---------YAB5                   --------->GLK1(1)  --------->GLK1(2) <---------ATHB12
---ANAC58                    --------->DOF5.7(1)  <---------GLK1(2)  <---------YAB5        <--------
---ANAC58      <-------TEIL---------->DOF2      ----------->ARR10  --------->WOX13(1)<---------KAN1-
---ANAC46 ------->GAMYB    <---------ZAT14 --------->YAB5   <---------MYB59 --------->AHL20(2)------
 
gaaacattaacaaccaagttcatatgggagtaaagagatctaaagatgaataagattcttataccaaattcaatcatattaaaacagagtatagctttaa  9987500
                                                                                      --------->REM1(1)
                                                                                      --------->MYB46(3)
                     --------->At4g35610                                      --------->GLK1(2)
                     ----------->RAV1(2)                                      --------->ARR14(2)
                    ------->TEIL                                             <---------GATA12
               <----------DOF2                                               --------->GATA12
        --------->ATHB12                                                     <---------GLK1(2)
        <--------HAHB4                                                       <---------RVE1(2)
       <---------YAB5<---------At4g35610                                     --------->ARR14(2)
 --------->TOE2(3)  <---------GATA12                                         <---------ARR14(2)
 --------->TOE1(3)  --------->GATA12                                        <---------At4g35610
--DOF2 <---------ATHB12   <---------At4g35610                 ------>ZmHOX2a(1)     ----------->RAV1(1)
------>TEIL   <---------ANAC58                       <---------KAN1         --------->KAN1
---->DOF2     <---------ANAC58      ------->TEIL   ----------->GT1         ----------->ARR10       <
 
agaaccttgaatcatttgctttgcatctgagatgctatgaaactgagataactcgagtaaaactcctccccatctagtcagattctgcaacaacaagaac  9987600
                                                                 ------->TEIL
                                                                 <---------ARR14(2)
                <---------DOF5.7(1)                              --------->GLK1(2)
               <---------MYB52(1)                                <---------GATA12
            <-------TEIL                                         --------->GATA12
           --------->ARR14(1)                                    --------->ARR14(2)
          --------->ARR11(1)                                    <---------GLK1(2)
          <---------ARR14(2)                           --------->RVE1(2)
          --------->ARR14(2)                      <---------GATA12
          <---------GLK1(2)                      --------->GLK1(1)
         --------->KAN1                          <---------GLK1(1)        --------->YAB5
        --------->DOF5.7(1)              ---------->DOF2<------ZmHOX2a(2) <---------ICU4
      ---------->DOF2                 --------->YAB1   <---------GATA12   --------->YAB1
 --------->RVE1(2)     <----------DOF2--------->YAB5   --------->GATA12  --------->ICU4       ------
---------AHL12(1)   <-----------GT1  <---------KAN1<------ZmHOX2a(2)     <---------ATHB12   <-------
 
aaaaaatcaaaaagattcgtttttttctttctgccatcgaatcacaaagcagagatcagatcgaactgaatctgaaatcatgaaatgaagagaaaactaa  9987700
                                                                                               <----
                                                                                               <----
                                                                                       --------->RVE1(2)
                                                                                       <---------ARR11(2)
                                                                                       --------->ARR11(2)
                                                                                       <---------ARR14(2)
                        <------MYB83                                                   --------->ARR14(2)
                  <---------ANAC58                                                     <---------ARR11(1)
                  <---------ANAC58                                                    <---------CCA1(2)
                  <---------ANAC46                                               --------->ARR11(2)
            --------->ARR14(2)       <------NtERF2                  ------>ZmHOX2a(1)--------->LBD16
            <---------GATA12        ------>NtERF2               --------->ARR14(2)  <---------ANAC58
       ---------->DOF2<--------P  ---------->ID1                --------->ARR11(2)  <---------ANAC58
    --------->At4g35610 <------MYB46(1)                         <---------ARR11(2)  <---------ANAC55(2)
    <---------At4g35610<---------TOE1(2)       <---------KAN1   <---------ARR14(2)  --------->ANAC55(2)
--->MYB52(1)<---------ARR14(2)   <---------RAP2.3(1)     <---------KAN1          --------->ARR14(2)-
--MYB52(2) <------ZmHOX2a(1)--------->KAN1    ------->TEIL   --------->YAB1      <---------ARR11(2)<
 
catcggcatctaaaggatttgacttgtaggtattttcggcgtcttgacgaatttgttcgaacaatagtatcctatcgaactcagtttccgtatccatggc  9987800
                                                                                <------NtERF2
                                                                               ------------>CBF
                                                                               ------>NtERF2
                                                                             --------->RRTF1(1)
                                                                             --------->RAP2.3(1)
                                                                            --------->LBD16
                                                                          --------->DEAR3(2)
                                                                        --------->CCA1(2)
                                                                       <---------ARR14(2)
                                                                       --------->ARR11(2)
                 <---------ANAC58                                 --------->RVE1(2)
                 <---------ANAC46                                *TSS  --------->ARR14(2)
                 <---------ANAC58                              --------->AHL20(3)       --------->ANAC58
      <----------DOF2             <----------DOF2              <---------AHL20(3)       --------->ANAC58
 ---------->DOF2--------------->AtSPL3                         <---------AHL12(2)       --------->ANAC46
-----ANAC58   <----------DOF2     <---------DOF5.7(1)          --------->AHL12(2)  <---------ATHB12
-----ANAC58  <---------DOF5.7(1) <---------ANAC58         ----------->GT1--------->MYB52(1)
-------->HSFB2a(2)               <---------ANAC58     <------NtERF2    <---------ARR11(2)       <---
---------HSFB2a(2)         <----------DOF2          --------->ANAC46  --------->At4g35610   <------NtERF2
 
ttctcaaagcttttcttctttcgtacaaaacttttggcttttcttctctcagacctcggcacagataaaaatcagataccggcgcaatgaaacgcagcgt  9987900
                                --------------->AGL15
                                ====================================================================
                               <---------ANAC55(1)
                               <---------ANAC46                                  <-------TEIL
                               <---------ANAC58                       --------->ICU4
                               <---------ANAC58        --------->MYB52(1)   <--------P
           ------------>CBF   --------->MYB52(2)       <---------ALFIN1<---------ICU4        <------
     --------->ZAT18        <<<<<<<<<MYB98      ---------->DOF2 --------->WOX13(2)           <------
     <---------ZAT18      <---------YAB1        --------->DOF5.7(1)   <---------YAB1         <------
------DOF5.7(1)         --------->YAB1     ----------->GT1      <---------WOX13(2)  --------->AtLEC2
 
ttttttagtgggcttacaatgggcctattatgttacttgtattagtttgtaaaaagcccaacgtcttaatttcatgatggtaagtccattcaaatggctt  9988000
                                                                --------->AHL20(3)
                                                                --------->AHL12(3)
                                                                <---------AHL20(3)
                                                              <---------AHL20(2)
                                                              --------->AHL12(3)
                                                              --------->AHL25(1)
                                                             <---------ARR11(3)
                                                             <---------AHL20(1)
                                                             --------->AHL25(3)
                                                       <-----------GT1
                                                     --------->KAN1
                                                    --------->AHL20(3)
                                                    <---------AHL25(1)
                                                    <---------AHL12(2)
                                                    <---------AHL20(2)
                                                    <---------AHL20(3)
                                                    <---------AHL20(1)
                                                    --------->AHL20(1)
                                                   --------->AHL20(2)
                                                   --------->AHL12(1)
                                                   --------->YAB1
                                                   <---------AHL12(1)
                                                   <---------AHL20(2)       --------->KAN1
                                                   --------->AHL25(3)      <---------AHL20(2)
                                                   <---------AHL25(3)      <---------AHL25(1)
     --------->YAB1                                <---------AHL25(1)      --------->AHL25(1)
 --------------->AGL15                             --------->AHL25(1)      --------->AHL25(2)
 <---------------AGL15                             <---------AHL12(3)      <---------AHL25(2)
----------------->AGL2                             --------->AHL12(3)      <---------AHL20(3)
<-----------------AGL2                           <---------AHL20(3)        --------->AHL20(3)
<-----------------AGL3                     --------->YAB5   <---------CCA1(2)         --------->RVE1(2)
----------------->AGL3              --------->ANAC58<---------AHL25(2)  <---------RVE1(2)   <-------
=================MADS_MADS          --------->ANAC58--------->AHL25(2)  --------->GATA12    --------
---ANAC58                   <---------GLK1(1)    --------->AHL25(2)     <---------GATA12--------->YAB5
---ANAC46                   --------->GLK1(1)    --------->AHL20(3)  --------->YAB1  <---------ICU4
---ANAC58  <---------WOX13(1)      --------->RVE1(2)<---------AHL25(3)  <---------GLK1(2) <---------YAB1
 
gtttccattaatagattgacatataacttggagttccatacccaaatgacaaaattatattccatatatttatcagattttattctaaaaatcactatag  9988100
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
                                                                                                 <--
                                                                                                <---
                                                                                                ----
                                                                                                ----
                ------->TEIL                                                                    ----
             <---------YAB5                                                                     <---
             <---------YAB1                                                                     <---
            <---------TOE2(3)                                                                   ----
         <---------AHL20(2)                                                                     <---
         --------->AHL20(3)                                            ----------->GT1          <---
         <---------AHL20(3)                                           ------->MYC3              ----
      <---------AHL20(1)                                              <-------MYC3              <---
      --------->AHL20(1)                                           ----------->RAV1(1)          ----
     --------->AHL12(2)                                          ------>MYB46(1)               -----
     <---------AHL12(3)                                          ------>MYB83                  <----
     <---------AHL12(2)                                          <-----------HVH21             <----
     --------->AHL12(3)                  <---------ANAC58       --------->ANAC46     --------->CCA1(2)
    <---------ARR11(3)                   <---------ANAC58     =================RAV  <---------ARR11(2)
    --------->ARR11(3)                  --------->ZAT2        --------->At4g35610   --------->ARR11(2)
    <---------AHL20(1)                  <---------ZAT2        ----------->RAV1(2)   --------->ARR14(2)
   <---------KAN1    --------->MYB52(2) --------->At4g35610   <---------At4g35610   <---------RVE1(2)
--ZAT14 --------->AHL12(2)              <---------At4g35610   --------->ZAT2        <---------ARR14(2)
->ZAT14 <---------AHL12(2)      <---------RVE1(2)             <---------ZAT2 --------->RVE1(2) -----
 
ttttgaatatatattaatgaatgttagtcacaagtgatatgtgagcttgcaatgtgactaatctcacctgccacatgtaaaatcacagatatgaaacaat  9988200
          <---------AHL25(1)
          --------->AHL12(1)
        <---------AHL12(2)
        --------->AHL12(2)
       <---------AHL20(2)
       <---------AHL25(3)
      --------->AHL25(3)
      --------->AHL20(2)
      <---------AHL20(2)
     <---------YAB1
  <---------YAB1
 --------->AHL12(2)
 <---------AHL12(2)
<---------AHL25(3)
-------->AHL25(2)
---------AHL25(2)
-------->AHL20(3)
---------AHL25(1)
---------AHL20(3)
-------->AHL25(1)
-------->AHL25(3)
---------AHL20(2)
---------AHL12(1)
-------->AHL20(2)
-------->AHL12(1)
---------AHL25(3)
-------->AHL20(1)
---------AHL20(1)
------->AHL12(2)
--------AHL12(2)
------>AHL12(2)
-------AHL12(2)
------AHL20(2)
----->AHL25(1)
----->AHL20(2)
----->AHL25(2)
------AHL25(2)
------ICU4<---------AHL12(1)
----->ATHB51                                                                       <-----------RAV1(1)
-----ATHB1<---------AHL20(2)                                                  <---------DOF5.7(1)
------AHL25(3)                           --------->DOF5.7(1)          --------->KAN1
----->AHL20(3)                           --------->DAG2              <---------ARR11(3)
------AHL12(1)                          --------->DAG2               --------->ARR11(3)
----->AHL12(1)                          --------->DOF5.7(1)        <---------TOE2(3)       <--------
---->AHL25(3)            --------->CCA1(2)                    <------ZmHOX2a(1)   <---------YAB1
-----ATHB51        --------->DOF5.7(1) --------->DOF5.7(1)--------->DOF5.7(1)<---------DOF5.7(1)
-----ATHB12      ---------->DOF2       ---------->DOF2  ---------->DOF2      <----------DOF2
---->ICU4--------->AHL25(3)--------->DOF5.7(1)      <---------ANAC55(2)     <---------DOF5.7(1)
 
aatttattattaaatatttgtaaagaagataagaggtttgcaaaaaggtagcatcacatgaaagaggattaagatgttcccttttattgttgttcttttt  9988300
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                            --------
                                                                                          --------->TOE2(3)
                                    --------->ANAC58                              --------->AHL20(3)
                                    --------->ANAC58                              <---------AHL20(3)
                            <---------AHL20(2)                                    <---------AHL12(3)
              <----------DOF2     ---------->DOF2              --------->ARR11(3)<---------AHL12(1)
           <---------YAB1   --------->AHL20(2)               --------->DOF5.7(1) --------->AHL12(1)
  <---------ANAC58          --------->AHL25(1)             --------->YAB1        <---------AHL25(2)
  <---------ANAC46        <---------WOX13(2)               ---------->DOF2      <---------RVE1(1)  <
  <---------ANAC58        --------->WOX13(2)            --------->YAB1         <---------RVE1(2)  --
<---------ANAC46      ------------------------>ANAC81  <---------YAB1  <---------KAN1    --------->YAB1
--DOF2   --------->KAN1  --------->YAB5          ----------->GT1      --------->RVE1(2) >>>>>>>>>MYB98
 
gttttgtgtgtgttattctttgaagaaacaattaaacaaaagccaaattgtatagtttataataaagatgtcgaatcaaactgatatttttaacataaac  9988400
<- Previous    Next ->

AGI:  At3g27080.1   
Description:  TOM20-3 (TRANSLOCASE OF OUTER MEMBRANE 20 KDA SUBUNIT 3); P-P-bond-hydrolysis-driven protein transmembrane transporter. Identical to Mitochondrial import receptor subunit TOM20-3 (TOM20-3) [Arabidopsis Thaliana] (GB:P82874;GB:Q9LSC8); similar to TOM20-1 (TRANSLOCASE OUTER MEMBRANE 20-1) [Arabidopsis thaliana] (TAIR:AT3G27070.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO49013.1); contains InterPro domain Plant specific mitochondrial import receptor subunit TOM20; (InterPro:IPR010547)
Range:  from: 9986316    to: 9987866    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version