AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                --------->ZAT2
                                                ----------->RAV1(2)
                                                <---------At4g35610
                                             <---------At4g35610
                                         ------>ZmHOX2a(2)
                                        <------ZmHOX2a(2)
      --------->LBD16                  <---------GATA12
      <---------LBD16                  --------->ARR14(2)                                  <--------
  --------->ARR11(2)                   ------->TEIL                                  --------->GLK1(1)
  --------->ARR14(2)                   --------->GATA12                              <---------GLK1(1)
  <---------ARR14(2)                   <---------ARR11(2)                        <---------WOX13(1)
  <---------GATA12   ==========================HOX2a_HOX2a                     --------->ATHB12
  <---------ARR11(2) <------ZmHOX2a(1) --------->ARR11(2)                      <--------ATHB1
  ------->TEIL       ===========================HOX2a_HOX2a                    --------->YAB1
---------YAB1 --------->DAG2           <---------ARR14(2)                     <---------ATHB12
-------ICU4   --------->DOF5.7(1)<---------ATHB12                             --------->ICU4  <-----
------>YAB1  --------->DOF5.7(1)--------->ANAC58<---------ZAT2          <---------ANAC58   ---------
----->ICU4   --------->DAG2     ------>MYB83--------->GATA12            <---------ANAC58  <---------YAB1
------YAB5  ---------->DOF2     ------>MYB46(1)<-----------RAV1(1)      <---------ANAC46--------->YAB1
--->YAB1    --------->DOF5.7(1) --------->ANAC58--------->At4g35610 <----------DOF2 <---------GATA12
 
tcatgaatccgagggaaaagggaaggagtagaaccaagcatggatcccatctgctgggcagtttgccattcctttgcgtcaatgatggatttcataataa  9900200
                                           --------->At4g35610
                                        <---------ANAC58
                                        <---------ANAC58
                                        <---------ANAC46
                                     <---------WOX13(1)
                                    <---------ANAC58
 <---------------AGL15              <---------ANAC58
 --------------->AGL15        <---------ALFIN1
 ------>ZmHOX2a(1)         --------->ANAC46<---------At4g35610
-ICU4            <---------ZAT6    --------->ATHB12             <---------GATA12                 ---
------GT1     <-----------------------TaNAC69(2)                --------->RVE1(2)         ------>ZmHOX2a(1)
>YAB1     ---------->DOF2 --------->MYB46(3)                    --------->GATA12         --------->TOE2(3)
 
cttcctgcttagagaaagaagtgatagcaaacaccacttgattgcgagcagtccataagttccatcaaatccaagggtatagaggtctccatcctaaacc  9900300
                                                                       --------->GLK1(2)
                                                                --------->WOX13(2)
                                                                <---------WOX13(2)
                                                            <------MYB46(1)                      ---
                                                            --------->ANAC58                     <--
                                                            <------MYB83                         <--
        <---------YAB5                                      --------->ANAC58                    <---
 <------ZmHOX2a(1)                       <----------DOF2   --------->MYB59 --------->ZAT14 ---------
--------->DOF5.7(1)                     <---------DOF5.7(1)--------->MYB46(2)             --------->DOF5.7(1)
------>LBD16                    ---------->DOF2           <--------P --------->KAN1      ---------->DOF2
 
cgtaggagggagacattgtctcttcttcacaagagcaaagccttcttttgtattagagagggtaggcaattgacattctatactctctgagcaaaagggc  9900400
                                                                       ---------->DOF2
                                                                    --------->HSFB2a(2)
                                                 --------->HSFB2a(1)--------->LBD16
                                                 <---------HSFB2a(1)<---------HSFB2a(2)
        --------->CCA1(2)                       --------->DOF5.7(1)--------->HSFB2a(2)
       <---------GATA12                   --------->At4g35610      <---------ANAC46
       --------->GATA12                   <---------ZAT14          <---------LBD16
------>At4g35610                          <-------TEIL             <---------HSFB2a(2)
-----GAMYB                                --------->ZAT18         <---------LBD16
-------At4g35610                         --------->ALFIN1     <---------HSFB2a(1)           <------ZmHOX2a(1)
------MYB46(3)    <---------MYB46(3)   <---------ANAC46       --------->KAN1 --------->At4g35610   <
>DOF5.7(1)       <---------AtMYB61    <---------MYB46(3)      --------->HSFB2a(1)      ----------->RAV1(1)
 
agttgaataagatgtgagtgatggtttcaaagtctctgcatcgggtgcagaaaggttctatagaaatgttccgggaaagcagttgagccccaacaggaag  9900500
                                                           --------->RVE1(2)
                                                        ------>MYB83
               --------------->AGL15                    ------>MYB46(1)
              ----------------->AGL3      <---------ARR11(3)
              <-----------------AGL2      <---------ARR14(2)
           <----------DOF2                --------->GATA12--------->CCA1(1)
          <---------DOF5.7(1)             <---------GATA12<---------KAN1
       <---------ZAT18                    <---------GLK1(2)<---------ARR11(3)
 --------->ATHB12             <---------RVE1(2)       <---------MYB59
 -------->ATHB1<---------------AGL15      --------->ARR14(2)                      <---------At4g35610
 --------->ATHB51      <------ZmHOX2a(1)  <---------RVE1(2)--------->ARR11(3)     --------->At4g35610
--------->ICU4----------------->AGL1      --------->ARR11(3)             --------->KAN1          <--
<---------YAB1----------------->AG      ----------->ARR10 --------->RVE1(1)   <-----------HVH21  <--
----------DOF2<-----------------AGL1<---------LBD16<------ZmHOX2a(1)     <---------MYB46(3)      ---
 
agcattattgagcgctttccaaatgaggagtttgatttttggggagattttcaaggaccaaatatctccaatccagttgttcgtcatatgagggactgga  9900600
                                                                         ------>MYB83
                                                                         ------>MYB46(1)
                                                                       <---------MYB59
                                                                    <---------ARR11(2)
                                                                    --------->ARR11(2)
                                                                    <---------ARR14(2)
                                                             --------->At4g35610
                                                        --------->At4g35610
                          <---------YAB1      <---------ZAT14--------->ZAT2           --------->ANAC58
        <----------DOF2 --------->O2         <---------ANAC46<---------At4g35610  <-----------HVH21
-------HSFC1(2)  <---------ANAC58            <---------REM1(1)     <------ZmHOX2a(1)  --------->ANAC58
-------HSFB2a(1) <---------ANAC58          <---------ANAC46  <---------ZAT2 <----------DOF2
------>HSFB2a(1)--------->MYB52(2)  <---------GLK1(2)   ----------->RAV1(2) <---------DAG2 <--------
 
gggttctatcgcattatgttccttgccacatgatagcccgattttgtggtgtagagaccatctgagctgaggaaccaaacttttttgtcaaggcataagt  9900700
                     --------->KAN1
                ----------->GT1
              <---------ANAC58
       <----------DOF2
      <---------ANAC58     <----------DOF2   --------->ATHB51
 <---------ANAC58 <---------YAB5   <----------DOF2
 <---------ANAC58 <---------ZAT6--------------->AGL15                                  xxxxxxxxxxxxx
<---------ZAT2<---------ANAC58  <---------YAB5                                    --------->HSFB2a(2)
<---------At4g35610 <---------RVE1(2)        --------->AHL20(2)                   <---------HSFB2a(2)
-KAN1 <---------ANAC58    --------->TOE2(3) --------->ICU4           <---------YAB1    <---------YAB5
 
gtttgctgggcttgatggctagtgatatacctttactgattttaggcattatttaggcatttgtttttgagtatttttgttatttctagagtcgtttcta  9900800
                                                           ------------>CBF
                                                           <------NtERF2
                                                          ------>NtERF2
                                                         <---------ATERF1(2)
                                                         --------->ATERF1(2)
                                                        --------->RAP2.6(3)
                                                   --------->ARR11(3)
                                                   --------->ARR14(2)
                                                   --------->RVE1(2)
                                                  <---------KAN1
                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                               <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                               <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                               <xxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                                              ------------>CBF
                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                              <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                                     --------->GLK1(2) --------->MYB52(1)
                                     --------->ICU4<---------ARR11(3)
                                    <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                        xxxx
                                  <---------RVE1(2)<---------ARR14(2)                          -----
                            ------->TEIL    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)              ------
                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                             <-----
                            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                             <-----
                          <-------TEIL <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)                   ------
                       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                                  <-----
                 ------->MYC3 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                           <-----
                 <-------MYC3 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                            ------
            <-----------GT1 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)      <---------ANAC58       <-----
<----------DOF2  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)----------->HVH21<---------ANAC58     <-------
xxxxxxxxxx>smallRNA(si3)--------->GATA12  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<----------DOF2------
 
ttccttttcatgtttttacacgttttagatgcatttggagattatggacaccaatatctgacggcaattcgatttcgagtctctttgaagttttaaagat  9900900
  --------->ARR11(2)
  --------->ARR14(2)
  --------->KAN4(2)
  <---------ARR11(2)
  <---------ARR14(2)
 <----------TaMYB80
 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
 --------->KAN1
 <---------KAN1
<---------RVE1(2)
xxxxxxxxxxxxxxxxxxx>smallRNA(le3)               --------->HSFC1(1)
---->CCA1(2)            <-------TEIL            <---------HSFB2a(2)
--->GATA12<---------HSFB2a(2)                   <---------HSFC1(1)                              <---
----RVE1(2)            xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                           --------->LBD16
----GATA12--------->HSFB2a(2)                   --------->HSFB2a(2)                 <---------LBD16
--->ARR11(1)           xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                      --------->ARR14(2)
----GLK1(2)--------->LBD16------->TEIL      --------->GLK1(1)                     <---------GATA12
----ARR14(2)         xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                         <---------ARR14(2)
--->ARR11(3)    <----------DOF2    --------->ICU4                                --------->GLK1(1)
----ARR11(3) <---------ARR11(3)    --------->GLK1(2)                             <---------GLK1(1)
--YAB5  ----------->RAV1(1)     <---------RVE1(2)                       <---------ANAC46        ----
--->ARR14(2)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                  --------->KAN1--------->KAN1-----
 
ttgcatattcgccccagaactttgggatgcatttggagattatggagaattctagaagaaaacatagaacttatgctgtagaagaaatccggagaccaaa  9901000
                                                             <---------AHL12(2)
                                                             --------->AHL12(2)
                                                            --------->AHL25(2)
                                                            --------->AHL25(3)
                                                            <---------AHL25(2)
                                                            --------->AHL25(1)
                                                            <---------AHL25(1)
                                                            <---------AHL20(1)
                                                            --------->AHL20(1)
                                                            --------->AHL20(2)
                                                            <---------AHL20(2)
                                                            <---------AHL12(3)
                                                            --------->AHL12(3)
                                                            <---------AHL25(3)
                                                           --------->AHL25(3)
                                                           <---------AHL25(1)
                                                           --------->AHL25(1)
                                                           --------->AHL12(3)
                                                           <---------AHL20(2)
                                                         --------->WOX13(2)
                                                         <---------WOX13(2)
                                                        --------->WOX13(1)
                                                      <------NtERF2                                <
                      ------>MYB83            --------->ARR14(2)                                  --
                     --------->ABI4(1)        --------->ARR11(3)                                 <--
                    --------->AtMYB61         <---------ARR11(3)                                 ---
                    --------->DEAR3(1)    <xxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)                     <--
                    <---------ALFIN1      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                   ---
                   --------->MYB46(3)    <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                     <--
            --------->ARR11(2)          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                     ---
            <---------ARR11(2)          <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)                      <--
            --------->GATA12 <-----------RAV1(1)    --------->ATERF1(2)                          ---
            <---------GATA12 <---------ZAT6   <---------ARR14(2)                                 <--
           <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  ----------->HVH21                              ----
          --------->ETT(2)--------->STY1(1)   --------->RVE1(2)   <---------ANAC58       --------->ARR14(2)
       --------->ALFIN1   <---------STY1(1)  <---------KAN1--------->AHL20(2)            <---------ARR11(3)
   <---------KAN1 ------>NtERF2     --------->ANAC46<---------ATERF1(2)                  --------->ARR11(3)
------ARR14(2)   --------->ANAC46 <---------ANAC58 --------->RAP2.6(3)                   <---------ARR14(2)
----->ARR14(2)<---------ETT(2)    <---------ANAC58--------->MYB52(1)                     <---------GATA12
---->KAN1<------NtERF2------>MYB46(1)   ------>NtERF2------>NtERF2<---------ANAC58       --------->GATA12
 
attcgcataggtgtcgatcgacaccacccctagtgttgctcgacaccaatatctgacggcaattaaatttcgagtctcttcgaagttttgaagatttgta  9901100
<- Previous    Next ->

AGI:  At3g26855.1   
Description:  similar to reverse transcriptase-related [Arabidopsis thaliana] (TAIR:AT2G02650.1); similar to contains similarity to reverse trancriptase , related [Medicago truncatula] (GB:ABN07997.1); contains InterPro domain RNA-directed DNA polymerase (reverse transcriptase), related (InterPro:IPR015706)
Range:  from: 9899917    to: 9900587    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version