AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
      --------->ARR11(3)
     --------->YAB1
  ---------->DOF2
<------NtERF2
-------->LBD16
---------RAP2.6(3)
----->NtERF2
------->RRTF1(3)
------->RRTF1(2)
------->RAP2.3(3)
------->RAP2.6(2)
------->RAP2.3(2)
------->DEAR3(1)
--------ATERF1(2)
------->ATERF1(2)
------>ATERF1(1)
----NtERF2
------>ORA47(2)
------>DEAR3(2)
------>RAP2.3(1)                                                                                   <
------>RRTF1(1)                                                        <----------DOF2             -
------>ERF1                                                      --------->ARR11(3)                -
----->At4g35610                 <------ZmHOX2a(1)                <---------ARR11(3)                <
------RAP2.3(1)               <---------TOE2(3)                 --------->GLK1(1)                  <
------At4g35610         <---------TOE1(3)                      <---------ARR11(2)                  <
------ATERF1(1)         <---------TOE2(3)                 <---------ANAC46                       <--
---->ARR14(2)        --------->DOF5.7(2)          --------->KAN1<---------GLK1(1)                ---
---->ARR11(2)        <---------MYB52(1)   --------->DOF5.7(1)<---------MYB46(3)   ------------>CBF -
-----ARR14(2)       <-------GAMYB       <------ZmHOX2a(1)<---------AtMYB61        *TSS           ---
-----ARR11(2)      <---------MYB46(3)<---------LBD16   <----------DOF2<---------DOF5.7(1)   <-------
 
gccgccaaagataaccaagaggtcgttaaggctaaggagaccaggaagaggctatatgctttggtggatatcatcttttgtttgtatcaatatttgtgtg  8692700
       <-----------TBP
       --------->AHL25(1)                                                                          <
       <---------AHL20(2)                                                                         <-
       --------->AHL12(3)                                         --------->RVE1(2)               <-
       --------->AHL20(3)                                        <---------ICU4                   --
       --------->AHL20(2)                                        --------->YAB1                   --
   <---------ICU4                                               <---------YAB5                    --
   --------->ATHB12                                             --------->ICU4                    <-
   <--------HAHB4                                              --------->AHL12(2)                 <-
  <---------ATHB12                                --------->WOX13(2)                              <-
  <---------YAB5                               ------>ZmHOX2a(2)<---------YAB1                    --
--------->WOX13(1)                           --------->ARR11(3)<---------WOX13(2)                 <-
<-----------GT1                              --------->RVE1(2) --------->WOX13(2)                 --
---------AHL12(1)                            <---------ARR11(3)<---------AHL12(2)                 --
-------->AHL12(1)                          <---------YAB5      <---------AHL20(3)                 --
-------->AHL20(2)                          --------->ICU4      --------->AHL20(3)                 <-
---------AHL20(2)                <-----------TBP  <---------WOX13(2)   ---------->DOF2           <--
---------AHL25(1)              <---------------AGL15          <---------ICU4--------->CCA1(2)    ---
---------AHL25(3)              --------------->AGL15         --------->AHL12(1)               ------
-------WOX13(2)               <-----------------AGL3         <---------AHL12(1)      ----------->GT1
------>WOX13(2)               ----------------->AGL2       --------->ANAC55(2)   --------->DOF5.7(1)
-------->AHL25(1)             ----------------->AGL3  <---------YAB1--------->YAB1 --------->DOF5.7(1)
------>AHL12(2)       --------->WOX13(2) --------->YAB1    --------->YAB1--------->DOF5.7(1)--------
--ANAC46     --------->ANAC46 <-----------------AGL2<-----------GT1<---------YAB1---------->DOF2 ---
 
aattaatcatttatataagaaacttatttgactcccatatatagtaatgatctaattaccatacataattatcaaaaagatagaaaaagagtcaaaatca  8692800
                                              --------->WOX13(2)
                                              <---------WOX13(2)
                                             <---------AHL25(3)
                                            --------->AHL12(1)                                   ---
              --------->AHL20(2)            <---------AHL12(1)                                   <--
              <---------AHL25(3)            <---------AHL25(3)                                   ---
   ----------->GT1                          --------->AHL20(1)                                   <--
---------AHL12(2)                           <---------AHL20(1)                                   <--
--------AHL20(1)                            --------->AHL20(2)                                   <--
--------AHL20(3)                            <---------AHL25(1)                                   ---
------->AHL20(3)                            --------->AHL25(2)                              --------
------->AHL25(1)                            <---------AHL25(2)                              <-------
------->AHL20(2)                            --------->AHL25(3)                              --------
--------AHL12(1)                            --------->AHL25(1)                              <-------
--------AHL25(1)                            <---------AHL20(2)                              --------
--------AHL25(3)                            --------->AHL12(3)                              --------
------->AHL25(3)                            <---------AHL20(3)                              --------
--------AHL25(2)                            <---------AHL12(3)                        <---------AHL20(2)
------->AHL25(2)                          --------->WOX13(2)               <------MYB83     <-------
------->AHL20(1)                    --------->ZAT18                        <------MYB46(1)  --------
------->AHL12(1)             ---------->DOF2--------->AHL20(3)            --------->MYB111(2)    <--
--------AHL20(2)          --------->TOE2(3)--------->AHL25(3)             --------->MYB111(1)    ---
-------ATHB12 <---------AHL20(2)  --------->ZAT14                         --------->MYB46(2)<-------
------>AHL25(3)        <---------GLK1(2)  <---------WOX13(2)              --------->MYB59--------->YAB1
--->YAB5    <---------WOX13(2)  --------------->AtSPL8                    <---------MYB46(3)<-------
->RVE1(2)   --------->WOX13(2)  <---------------AtSPL8                <---------ZAT6 --------->AHL20(2)
------>AHL20(2)       --------->YAB5<---------ZAT14         <-----------GT1<---------ANAC46 <-------
 
ataaattagtaactaaattaaaaactgattcttaaagagtactctaattaattagagagaaatttacaaactagtgtttggtagactattaaaaataaaa  8692900
         --------->ANAC46
    ------->TEIL
  --------->YAB5
------>AHL25(2)
-------AHL20(3)
------>AHL20(2)
-------AHL20(2)
-------AHL25(1)
-------AHL25(2)
------>AHL20(1)
->AHL20(1)
--AHL12(3)
->AHL20(2)
--AHL20(2)
->AHL25(1)
->AHL20(3)
->AHL25(3)                                ---------->DOF2                                         <-
--AHL25(2)                           <---------------AGL15                                        <-
->AHL25(2)                           --------------->AGL15                                        <-
-------AHL25(3)                     ================================================================
------>AHL25(1)                     ----------------->AGL3         <------ZmHOX2a(1)              <-
--AHL25(1)                       --------->RVE1(2)                ----------->GT1   <----------DOF2-
--AHL20(3)                       --------->GLK1(2)      --------->ATHB12   <---------YAB1         <-
--AHL25(3)       <-----------GT1<---------GLK1(2)      <---------YAB1  <---------AHL20(3)         --
 
taaaatgaatcaacaccatttttcattctcttcaagaatcccattaaaagtcaaaaccatgtttgggctaggaaaaatatgtttgggctttagtaggccc  8693000
                                                                                 <---------AHL12(3)
                                                                                 --------->AHL12(3)
                                                                                 --------->AHL20(3)
                                                                                 <---------AHL25(1)
                                                                                 <---------AHL20(3)
                                                                                 <---------AHL12(2)
                                                                                 <---------AHL25(3)
                                                                                --------->AHL25(1)
                                                                                <---------AHL20(2)
                                                                                <---------AHL25(1)
                                                                                <---------AHL25(3)
                                                                        ----------->GT1
                                                                   --------->AHL12(3)
                                                                   <---------AHL12(3)
                                                                   <---------AHL20(3)       --------
                                                                   --------->AHL20(3)       <-------
                                                                 --------->AHL20(2)         --------
                                             <---------ARR11(2)  <---------AHL20(2)         <-------
                                            --------->At5g28300  <---------AHL25(1)        *TSS
                                            <-------GAMYB    <---------AHL12(3) --------->AHL20(2)
                                           <---------DEAR3(2)--------->AHL12(3)--------->AHL20(2)
                                --------->YAB1              <---------ICU4     <---------AHL20(2)
                               <---------YAB5--------->ARR14(2)  --------->AHL12(3)  <---------YAB1
            ------->GAMYB      <---------YAB1--------->ARR11(2)  ----------->TBP--------->AHL25(3)
            <---------------AGL15       ------------>AtMYB77<---------AHL20(2) --------->AHL20(3)
         <-----------GT1       --------->ICU4<---------ARR14(2)  <---------AHL12(3) --------->ARR11(3)
-------->P ----------------->AGL3 <---------YAB1           --------->AHL20(2)  <---------AHL20(3)
--------MYB111(1)         ----------->GT1  ----------->GT1--------->AHL12(2)  --------->AHL12(2)
--------MYB52(2)       --------->MYB52(1)  <---------MYB46(3)<---------AHL12(2)--------->AHL25(3)
--------MYB55(2)       ------------>MYB.PH3(1)            <---------WOX13(2)  --------->WOX13(2)
=============================MADS_MADS  ------------>MYB.PH3(1)  --------->AHL25(1) <---------ARR11(3)
--------MYB111(2)      <---------DOF5.7(2)<---------DEAR3(1)<---------AHL25(3)<---------WOX13(2)
------>GAMYB--------------->AGL15--------->TOE2(3)        --------->WOX13(2) <---------WOX13(2)
--------MYB46(2)  --------->DAG2--------->YAB5        --------->ANAC55(2)   --------->AHL20(2)     -
------->MYB46(3) ---------->DOF2<--------HAHB4        <---------ANAC55(2)  <---------AHL20(2)  <----
 
aactacccaaaataaccacataaagtaaacggttatcattaatgggcggttactaatacttaataaatataaatatagttaaattaatatcatttctaga  8693100
                                                                               <----------DOF2
                                                                              <---------ANAC58
                                                                              <---------ANAC58
        <-----------GT1                                               ------>NtERF2
     <---------ICU4                                                  ----------->HVH21
    ------>ZmHOX2a(1)                                                --------->DEAR3(1)
   --------->TOE2(3)                                                 <---------DEAR3(1)    <--------
  --------->YAB1                                                    --------->RAP2.3(1)    ---------
->HSFB2a(2)                                                        --------->LBD16       <---------LBD16
--HSFC1(1)                                                         <---------ATERF1(1) --------->ARR11(2)
->HSFC1(1)               --------->RVE1(2)           <---------MYB52(1)<------NtERF2   <---------ARR14(2)
--HSFB2a(2)      <----------DOF2              --------->KAN1      --------->DEAR3(1)   --------->ARR14(2)
-------->KAN1   <---------DAG2               <---------ARR14(2)  <---------LBD16   <-----------GT1
-----ARR11(3)   <---------DOF5.7(1)          --------->ARR14(2)<-----------GT1<---------ANAC46<-----
 
gcttatcctaatttctctccctttcgaaaatcgaaacaaatcggtgcgattactccgttttgaatttcaccggcgacgatggctttgaacaatccgcgaa  8693200
                                                          <---------DOF5.7(2)
                                                --------->ANAC46
        --------->ARR11(3)                 <---------SPL7(1)
        <---------ARR11(3)                --------->DEAR3(1)
       --------->GLK1(1)                 --------------->AtSPL3
       <---------GLK1(1)                 --------------->AtSPL8        --------->LBD16
       <---------RVE1(1)               ------->GAMYB     <---------ARR11(2)
       --------->RVE1(1)              --------->MYB46(3) --------->ARR14(2)        <-----------HVH21
      <---------ARR11(3)             ------>MYB46(1)     <---------ARR14(2)        --------->TOE2(3)
 --------->ANAC46           --------->At4g35610--------->HSFB2a(2)    <---------ANAC55(2)    <------MYB83
<---------LBD16   <---------TOE2(3)  ------>MYB83        --------->ARR11(2)       <----------ID1
-HSFB2a(2)     <---------DAG2     --------->MYB46(3)    --------->DOF5.7(2)    --------->DOF5.7(1)
>LBD16--------->ARR11(3) <---------At4g35610   <---------HSFB2a(2)    <---------ANAC58       <------MYB46(1)
---------OsCBT <----------DOF2   ------->TEIL--------->SPL7(1)        <---------ANAC58---------->DOF2
 
gaacacggagatatctcgctttaggtttagccgatgaaccaatcgccgtaccagaaaccgtttacgctcaagtccgtgagaaaaaacgtcaaagcttggt  8693300
                               --------->ZAT14
                               <---------ZAT14
                           ------>ZmHOX2a(2)
                          <------ZmHOX2a(2)
                          --------->GLK1(1)
                         <---------AGP1                                    --------->CCA1(2)
                         --------->ARR14(3)                                <---------KAN1
                         --------->GATA12                                 --------->ARR14(2)
                         <---------ARR11(3)                               <---------RVE1(2)
                         <---------GATA12                              <---------TOE2(2)
                         --------->ARR14(2)                            <---------TOE1(2)  --------->ANAC58
                         <---------ARR14(2)                        <---------LBD16<-----------HVH21
                         --------->ARR11(3)                 --------->ALFIN1    ------->TEIL
                         <---------ARR14(3)                 <---------AtMYB61<---------YAB1
                  <----------ID1                          <---------ANAC58<---------ARR14(2)
              <---------HSFB2a(2)        ------>ZmHOX2a(2)<---------ANAC46<---------ARR11(2)       <
              --------->HSFB2a(2)    ----------->HVH21    <---------ANAC58--------->ARR11(2)  <-----
    <---------ARR11(3)   --------->RVE1(2)               --------->ATHB12<------ZmHOX2a(1)--------->ANAC58
 
ttgtcgagttcttagccctagaagacaagatctctactctgtgatcgataaactccgtcttgagtggtgtctcggaggatatgaatgtcatggacgcatt  8693400
      <------NtERF2
     ------>NtERF2
     --------->LBD16
    <---------ANAC46
   <---------LBD16
   --------->ATERF1(1)
   <------NtERF2
  ------>NtERF2
  <---------ATERF1(1)
  <---------RRTF1(1)
  <---------DEAR4(2)
  <---------ERF1
  <---------RAP2.3(1)
  <---------ORA47(2)
  <---------RAP2.6(1)
 <---------DEAR3(1)
 --------->ATERF1(2)
 <---------ATERF1(2)                                              ------>ZmHOX2a(1)
 --------->DEAR3(1)                                          <------MYB83
 <---------RAP2.6(2)                                         <------MYB46(1)
 <---------RAP2.3(2)                                        <---------AtMYB61               <-------
 <---------RRTF1(3)                                         --------->MYB59              <---------MYB52(1)
 <---------RRTF1(2)             --------->DOF5.7(1)         <---------MYB46(3)          <-------GAMYB
 <---------RAP2.3(3)           --------->DOF5.7(1)          --------->MYB111(1)      <---------ANAC46
<---------LBD16                ---------->DOF2             <--------P          <---------MYB46(3)
<---------ABI4(1)  <---------ANAC58                       <-------GAMYB ------->MYC3 <---------ANAC58
--------->ATERF1(1)<---------ANAC46    --------->GATA12  --------->MYB55(2)   <---------WOX13(1) <--
---------RAP2.3(1) <---------ANAC58    <---------GATA12  <---------MYB46(3)<---------MYB46(3)    ---
----KAN1    <-----------HVH21---------->DOF2          <----------DOF2   <-------MYC3 <---------ANAC58
 
atcggcggcgggaagtgtcagttcgtgtttgagaaagagcgggatttagaaatggttctttggttggtccttacacgtttgatggatggctcgttgtgtt  8693500
                                                                                               <----
                                                                   <---------ARR11(2)          <----
                                                             <---------LBD16                   -----
                                                             --------->TOE1(2)                 -----
                                                            <---------ANAC46                   <----
                                                            <---------ANAC58                   <----
                                                            <---------ANAC58      <----------DOF2
                                                 <---------MYB46(3)--------->GLK1(2)        --------
                                              <-----------RAV1(1) <---------GLK1(1)        ---------
                                       --------->ATERF1(1) <-------TEIL        --------->GLK1(2)
                                      <---------ORA47(2)  --------->CCA1(2)    <---------ARR14(2)
         <---------At4g35610          <---------DEAR3(2) --------->ARR11(1)    <---------ARR11(1)
         --------->At4g35610          <------MYB46(1)    --------->ARR14(2)    --------->RVE1(2)   <
--------->ARR14(2)                    <---------ATERF1(1)--------->GATA12      --------->ARR14(2)  <
<---------ARR14(2)                    <------MYB83<-------GAMYB<---------TOE1(2)<---------YAB1<-----
<---------ARR11(2)                   <---------DEAR4(1)  <---------ARR14(2)    <-----------ARR10   -
----RAV1(1)            ------>ZmHOX2a(1) ------>NtERF2   <---------GLK1(2)     <---------ARR11(3)  <
-------HSFB2a(2)   <---------ARR11(3)<---------DREB2C(2) <---------ARR11(2)    --------->ARR11(3) <-
-------------->AGL1--------->ARR11(3)<---------DEAR3(1) --------->KAN1<---------YAB1       <--------
 
gcagaaatgggaagatgagcaaggtcctgagtttttgaagtcggtgcctatgtggttgaagattcgtgggattccgattcagtatctttgtgatgggacg  8693600
<- Previous    Next ->

AGI:  At3g24068.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24065.1); contains InterPro domain Plant self-incompatibility S1 (InterPro:IPR010264)
Range:  from: 8692198    to: 8692683    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g24070.1   
Description:  zinc knuckle (CCHC-type) family protein. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G13450.1); contains InterPro domain Zinc finger, CCHC-type; (InterPro:IPR001878)
Range:  from: 8693092    to: 8694716    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version