AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                         <---------ARR11(3)
                                         --------->RVE1(2)
                              <---------ICU4
                              --------->YAB5
                             --------->ICU4
                             <---------YAB1
                           --------->YAB1--------->ARR11(3)
                          <---------AHL20(2)
                         <---------AHL20(1)
                         <---------AHL25(2)
                         <---------AHL25(3)
                         <---------AHL25(1)                                               --------->RVE1(2)
                         <---------AHL20(2)            <-----------GT1                    <---------
                         --------->AHL20(2)     <---------ARR11(3)                        --------->GATA12
                         --------->AHL20(3)     --------->GATA12                          --------->GLK1(2)
        <-----------GT1  <---------AHL20(3)     --------->ARR11(3)                        --------->ARR14(2)
------->ALFIN1           --------->AHL25(2)    <---------CCA1(2)                          <---------ARR11(3)
----------RAV1(1)        --------->AHL20(1)--------->TOE2(3) --------->ARR11(3)           <---------GATA12
------ANAC58          --------->AHL20(3) --------->AHL20(1)  <---------ARR11(3)     <-----------GT1
------ANAC46          --------->AHL20(2)--------->CCA1(1)  <---------YAB1       --------->ICU4
------ANAC58    ------>ZmHOX2a(1)       --------->RVE1(1)--------->YAB1      ---------->DOF2       -
 
agtgttgcaatttgctatcctccaaaaatataatgactacaaaatatcttaaatcttttttcatgatattaaacttaagtgaaagtattacaaaatctga  6632300
                                                                                     <---------AHL25(3)
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL20(2)
                                                                                    <---------AHL12(3)
                                                                                    --------->AHL12(3)
                                                                                    <---------AHL12(1)
                                                                                    <---------AHL25(3)
                                                                                    <---------AHL25(1)
                                                                                    --------->AHL12(1)
                                                                                    --------->AHL25(1)
                                                                                <---------AHL20(2)
                                                                                --------->AHL20(2)
                                                                               --------->AHL20(2)
                          <----------DOF2            --------->YAB1 --------->AHL25(1)
                     --------->KAN1              <---------AHL12(1) <---------AHL20(2)
            --------->ANAC46                ----------->GT1      --------->GATA12 --------->WOX13(2)
--ARR10     <-----------GT1           <---------AHL20(2)         <---------GATA12 <---------WOX13(2)
---------->GT1--------->ANAC46 --------->LBD16   --------->AHL12(1) --------->AHL20(2)
 
tcaagttaaaagtttacaccagacatatactttccaggtatttgattcagaaaaaatcatattgatcagatttaaacaaattttaaattatatataagtt  6632400
                  --------->TOE2(3)
               <-----------GT1
             <---------AHL25(3)
             <---------AHL25(1)
             --------->AHL25(1)                         <---------ANAC58
             --------->AHL20(2)                         <---------ANAC58
           --------->WOX13(2)                      <----------CDC5
           <---------WOX13(2)                <---------ANAC58
      --------->ANAC46                       <---------ANAC58                      <---------RVE1(2)
      --------->ANAC58   <---------ICU4   <--------P   --------->At4g35610   --------->KAN1     <---
      --------->ANAC58   --------->YAB5<---------ZAT6  --------->ZAT2        <---------KAN1 <------NtERF2
 
ttttcttacacacaaattaaacctttgatcagtactagactactggtagcatgcgatgagcttgcagtagtttctctcgcacattagttatgggccgaga  6632500
                                                           <---------ANAC55(2)
                                                           <---------ANAC46
                                                           <---------bZIP60(1)
                                                           --------->bZIP60(1)
                                                           <---------ANAC58
                                                           --------->ANAC55(2)
                                                           <---------ANAC58 <-----------HVH21
                                                           <---------ANAC55(1)
                                                        --------->ALFIN1   <---------O2
                                                       <-------MYC2        --------->O2
                                                       <-------MYC3        --------->bZIP60(2)
                                                       <-------MYC4        --------->TGA1a
                                                       ------->MYC2 ------->MYC3
                                                       ------->MYC4 <-------MYC3
                                                       ------->PIF5--------->ANAC55(2)
                                                       <-------PIF5<---------ANAC55(2)
                                                       ------->MYC3<---------O2 --------->O2
                                                      --------->TGA1a      <---------TGA1a
                         --------->AHL12(1)           >>>>>>>>>>HY5--------->ANAC46
                         <---------AHL25(3)           <---------O2 --------->TGA1a
                        --------->AHL25(2)            <---------PIF3(3)    =========================
                        <---------AHL20(3)            --------->ANAC46     --------->ANAC46
                        <---------AHL25(2)            --------->PIF3(3)    --------->ANAC58
                       --------->AHL12(2)        --------->RVE1(2) <---------TGA1a
                       <---------AHL12(2)        <-----------GT1   --------->bZIP60(1)
                     --------->AHL20(2)        <---------YAB1      <---------bZIP60(2)
                    <---------KAN1            --------->WOX13(2)   --------->O2 <---------O2
                  ----------->GT1          ==================================bZIP_DOF<---------ANAC46
                 ----------->GT1    <---------ARR11(3)=======================bZIP_bZIP
                <---------ANAC46 --------->HSFB2a(2)  --------->O2 <---------bZIP60(1)
             ----------->HVH21   <---------HSFB2a(2)  <---------TGA1a----------->HVH21            <-
           --------->LBD16  <---------YAB5 =====================bZIP_DOF   --------->ANAC58     <---
       <-----------HVH21--------->AHL20(3) ==========================================bZIP_DOF   <---
------ZAT2<---------LBD16<---------AHL12(1)<----------DOF2<------NtERF2  <---------ALFIN1      -----
 
gctaggcccatgtccagggacggataaaataatcttccagatgtttctttattatccacgtggcgtgatcacgtgaccacgtctcgtctcgtctagtcct  6632600
                       <---------At4g35610
                       <------NtERF2                                      --------->RVE1(2)
                       <---------ZAT2 <-----------GT1            --------->DOF5.7(1)
                     <-----------RAV1(2)                        --------->DOF5.7(1)
                     --------->ATERF1(2) <-----------TGA1       ---------->DOF2
      <---------ARR14(2)        <---------DAG2              <---------------AGL15
      --------->ARR14(2)   <-------GAMYB <-----------HVH21 --------->HSFB2a(2)
  --------->At4g35610<---------ATERF1(2)--------->YAB1     <-----------------AGL1
=========================bZIP_DOF   <---------YAB1         <---------HSFB2a(2)   *TSS
--------GLK1(2)      <---------WRKY12 >>>>>>>>>>GATA-1  <----------DOF2  --------->YAB1
------TOE2(2)      ------>NtERF2<---------MYB59   --------->ANAC58 ----------->GT1<<<<<<<<<WRKY18
------TOE1(2) <----------DOF2   --------->TOE1(3) --------->ANAC46--------->DAG2<-----------HVH21
->ZmHOX2a(1) <---------DOF5.7(1)--------->TOE2(3) --------->ANAC58--------->DOF5.7(1)      ---------
 
agattagcagagcctctctttcggccagcgggttaccttattatcgtcacaagacgaaactttcagaaaaaggcaaaaatcactgtcaaaactcaaaagc  6632700
                                                                                                ----
                                                                                               <----
                                                                                         --------->MYB52(2)
                                                            --------->At4g35610         <---------TOE1(2)
                                                            --------->ZAT2             <---------MYB52(1)
                <---------DOF5.7(1)   ----------->RAV1(1)   <---------At4g35610      --------->MYB52(2)
       <<<<<<<<<CBP60g           <---------GLK1(1)          <---------ZAT2           <---------ANAC58
       <<<<<<<<<SARD1            --------->GLK1(1)   <---------ICU4                  --------->KAN1
      ------>MYB83       ------>ZmHOX2a(1)           --------->YAB5                  <---------ANAC58
    <---------MYB59<-----------GT1<---------GATA12  --------->ICU4--------->ANAC46   <---------MYB46(3)
->DOF2------>MYB46(1)    --------->At4g35610        <---------YAB1--------->ZAT6    <-------TEIL<---
 
cttgagaccaaatttccgattttttctcctctgaagaaatccaacaaattgtaccatgattccagcttcactctacttcttctagggttcgttcgttttc  6632800
                                                                                                <---
                                                                                                <---
                                                                              --------->ZAT2    ----
       --------->ANAC58                                            --------->RVE1(2)            ----
       <---------ANAC55(2)                                        <---------KAN1                <---
       --------->ANAC58                                          --------->GATA12          <--------
       <---------ANAC46                                          --------->ARR14(2)    <-------TEIL
       --------->ANAC55(2)                                      --------->ARR14(2)   <---------GLK1(2)
      <---------LBD16                                           <---------ARR14(2)  <---------ZAT2
  <-----------RAV1(1)                                           <---------GLK1(2)   --------->ZAT2
  <---------MYB46(3)                --------->ARR14(2)          --------->ARR11(2)  --------->At4g35610
--------->At4g35610                 <---------ARR14(2)        --------->LBD16 <---------ZAT2    ----
<---------At4g35610          --------->GLK1(1)              <---------LBD16   --------->At4g35610
----->HSFB2a(2)      <---------ANAC58                    <----------DOF2      <---------At4g35610 --
-----LBD16           <---------ANAC58       <---------DOF5.7(1) <---------ARR11(2)<---------ALFIN1==
------HSFB2a(2)     --------->At4g35610   <---------DOF5.7(1)--------->ANAC55(2)----------->RAV1(1)
 
tggagctgttgcgcaatgccagtagcttacacatttccagttctcccttcttcttgtctgctttgcggaatctccaatcgcagcaccagcttcgtcgtag  6632900
               ==================HOX2a_HOX2a
             <---------AGP1
             --------->RVE1(2)
             --------->AGP1
             <---------ARR14(2)
             --------->GATA12
             <---------GATA12                                                     <---------ARR14(2)
             <-----------ARR10                                                    <---------ARR11(2)
             --------->ARR11(3)                                                   --------->ARR11(2)
             --------->ARR14(2)                                                  <-------GAMYB
      <---------At4g35610                                                       <---------DEAR3(2)
      --------->ZAT2                                                            <---------MYB46(3)
      --------->At4g35610                 --------->GATA12                   <---------RRTF1(1)
     <---------ARR14(2)                   --------->ARR11(2)                 <---------RAP2.3(1)
     --------->ARR14(2)   ------>ZmHOX2a(1)                                 <---------DEAR3(1)
   --------->LBD16   --------->GLK1(1)    --------->ARR14(2)                <---------RAP2.3(3)
  --------->ANAC46  --------->GATA12      <---------ARR14(2)                <---------RRTF1(2)
 <---------LBD16  <---------TOE1(2)       <---------GATA12                  <---------RAP2.6(2)
------ARR14(2)<------ZmHOX2a(2)           <---------ARR11(2)                <---------RRTF1(3)
------ARR11(2)--------->GLK1(1)   <---------MYB46(3)                        <---------RAP2.3(2)
----->ARR14(2)<---------GLK1(1)   --------->MYB52(2)                       <---------LBD16
----->ARR11(2)===================HOX2a_HOX2a  ----------->GT1           <----------DOF2
------GATA12 <---------ARR11(3)  <---------TOE1(2)          <---------ARR14(2) <---------DEAR3(1)
-ANAC46     <---------At4g35610<---------SPL7(1)            --------->ARR11(2) <---------ANAC46
----->GATA12<---------CCA1(2)<---------YAB5   --------->LBD16         <---------YAB1
---->ZmHOX2a(2)------>ZmHOX2a(2)<---------MYB52(1)          --------->ARR14(2)<------NtERF2    <----
=================================HOX2a_HOX2a<---------LBD16 <---------ARR11(2)------>NtERF2   ------
 
atcgcccggagcttcagatctcaggtctcctcgtcgttcgttctgaatccggtgaattcttcggttctggtttatctttgcggcggtttcagcgagaagg  6633000
                                                     --------------->AtSPL8
                                                 --------->DEAR3(1)
                                                 --------->RAP2.3(3)
                                                 --------->RAP2.3(2)
                           <---------ARR11(2)   <------NtERF2
                           --------->ARR11(2)   --------->DEAR4(2)
                 <-----------RAV1(1)            --------->RAP2.3(1)
                <---------ANAC46                --------->ORA47(2)
           <-----------RAV1(1)        --------->ETT(2)
     <-------GAMYB        --------->GLK1(1)     --------->ATERF1(1)             --------->ZAT6
    <---------MYB46(3) <---------AtMYB61       <---------RAP2.3(1)            -------->P           <
    ----------->GT1  <---------MYB46(3)   ---------->DOF2                     ------->TEIL        --
   <---------AtMYB61<---------AtMYB61 <---------ETT(2)                    <---------GATA12       ---
  <------ZmHOX2a(1) --------->ALFIN1 <------NtERF2<-----------HVH21       --------->GATA12      <---
--ZmHOX2a(1)   <---------ZAT2    <-----------HVH21------>NtERF2           ------->TEIL      <-------
--->DOF5.7(1)  <---------At4g35610 <---------ANAC46  --------------->AtSPL3<---------At4g35610 -----
 
acggaggaggttgaatgctgctggtggtggtatccatgtcgtcgacaatgcgccgtctcgtacttcttctctcgctgcatctacctctacaatcgaactc  6633100
        <-----------GT1
   <---------ANAC55(1)
   <---------bZIP60(2)
   --------->ANAC55(2)
   <---------ANAC58
   <---------ANAC55(2)
   <---------ANAC58
   <---------ANAC46
<---------ARR14(2)
--------->ARR11(2)
<---------MYB52(1)                                     <---------ARR11(2)
<---------ARR11(2)                            <---------KAN1
--------->ARR14(2)                           --------->GLK1(2)
-----------HVH21                            <---------GLK1(2)
------->LBD16                               --------->ARR14(2)
------>LBD16                                --------->ARR11(2) --------->RVE1(2)
------LBD16                          <----------DOF2   <---------ARR14(2)            <---------At4g35610
--GLK1(1)                 ------>NtERF2 <---------LBD16--------->ARR14(2)--------->ARR14(2)
---->MYB52(1)  <---------RVE1(1)     <---------DAG2    <---------RVE1(2) --------->GATA12 ------>ZmHOX2a(1)
 
ccggttacgtgttaccaggtattttgctccgactgacttacttttcggaatctctgtagatactactatctctcgcgatttgctacttagctcctcgttg  6633200
<- Previous    Next ->

AGI:  At3g19180.1   
Description:  ARC6H. similar to ARC6 (ACCUMULATION AND REPLICATION OF CHLOROPLASTS 6) [Arabidopsis thaliana] (TAIR:AT5G42480.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48483.1); similar to H0103C06.10 [Oryza sativa (indica cultivar-group)] (GB:CAJ86106.1)
Range:  from: 6632682    to: 6637230    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version