AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL25(1)
                                                                                     <---------AHL12(3)
                                                                                     <---------AHL25(1)
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL12(1)
                                                                                     --------->AHL12(1)
                                                                                     --------->ATHB12
                                                                                     --------->ATHB51
                                                                                    --------->AHL25(3)
                                                                                    <---------AHL25(1)
                                                                                    --------->AHL25(2)
                                                                                    --------->AHL25(1)
                                                                                    <---------AHL12(3)
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL12(3)
                                                                                    <---------AHL25(2)
                                             <---------AHL20(3)                     --------->AHL12(1)
                                             --------->AHL25(1)                     <---------AHL12(1)
                                             --------->AHL20(3)                    --------->AHL25(2)
                                             <---------AHL25(2)                    --------->AHL12(2)
                                             <---------AHL25(1)                    <---------AHL25(2)
                                             --------->AHL20(2)                    <---------AHL20(3)
                                             <---------AHL25(3)                    --------->AHL20(3)
                                             --------->AHL25(2)                    --------->AHL12(3)
                                             <---------AHL20(2)                  <---------YAB1
                                            --------->AHL25(3)                  --------->AHL25(1)
                                            --------->AHL20(2)                  --------->AHL12(3)
                                         <---------AHL12(1)                     --------->AHL20(2)
                                        --------->AHL25(2)                      <---------AHL25(1)
                                        --------->AHL20(1)                      --------->AHL20(3)
                                        --------->AHL12(1)                      <---------AHL20(3)
                                        <---------AHL12(1)                      <---------AHL25(2)
                                        <---------AHL20(1)                      <---------AHL20(2)
                                        <---------AHL25(2)                  --------------->AGL15
                                        <---------AHL20(3)             --------->AHL12(1)
                     --------->ANAC58   --------->AHL25(3)            <---------AHL12(2)
               --------->AHL20(2)       --------->AHL20(2)           --------->AHL12(3)
          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                      --------->AHL25(1)
       ----------->GT1                  --------->AHL20(3)           <---------AHL20(2)
     ---------->DOF2 --------->ANAC58   <---------AHL20(2)           <---------AHL25(2)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <---------AHL12(2)        --------->AHL25(2)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3) --------->AHL12(2)       --------->AHL20(2)         -----
-------->KAN1  <---------AHL25(3)      --------->AHL12(2)        --------->YAB1 <---------AHL25(3)
->ZmHOX2a(1)  <xxxxxxxxxxxxxxxxxxxsmallRNA(se3)                 <---------YAB5 --------->YAB1 <-----
--->TOE2(3) <---------WOX13(2)       --------->AHL20(2)   <-----------GT1   ========================
 
aaaaatgcgaaagtaaaataaaacaggctatgctaaattttaaaatattaaattcaacatttttctattcataaaatttctattaaaattatttgtagat  6336300
                                                                            --------->RVE1(2)
                                                                            <---------ARR11(3)
                                                                           <---------CCA1(2)
                                                                          <---------AHL25(2)
                                                                          --------->AHL25(2)
                                                                          <---------AHL25(3)
                                                                          --------->AHL20(1)
                                                                          <---------ARR11(3)
                                                                          --------->ARR11(3)
                                                                          <---------AHL20(1)
                                                                         <---------AHL12(2)
                                                                         <---------AHL12(3)
                                                                         --------->AHL12(3)
                                                                         <---------AHL25(1)
                                                                        --------->AHL12(2)
                                                              --------->AHL12(1)
                                                              <---------AHL12(1)
                                                              --------->AHL25(2)
                                                              --------->AHL20(3)
                                                              <---------AHL25(2)
                                                              <---------AHL20(3)
                                                             --------->AHL12(2)
                                                             <---------AHL12(2)
                                                            <---------AHL25(1)
                                                            --------->AHL25(1)
                                                            --------->AHL12(3)
                                                            <---------AHL12(3)
                                                            --------->AHL25(2)
                                                            <---------AHL25(2)
                                                            <---------AHL25(3)
                                                            <---------AHL20(2)
                                                           <---------AHL20(2)
                                                           <---------AHL20(1)
                                                           --------->AHL20(2)
                          --------------->AGL15            --------->AHL12(3)
                          <---------------AGL15            --------->AHL25(3)
                         <-----------------AGL3            <---------AHL25(2)
                        ------>ZmHOX2a(1)                  --------->AHL20(1)
                  <---------ICU4                           <---------AHL12(3)
                  --------->KAN1                           --------->AHL25(2)
                 <---------YAB1                            --------->AHL25(1)          --------->KAN1
                --------->TOE2(3)                          <---------AHL25(1)     ----------->GT1
               --------->YAB5                              <---------AHL25(3)    <---------TOE2(3)
               <---------ICU4     <------ZmHOX2a(1)   --------->AHL20(2)<---------AHL12(2)
---->CCA1(2)   --------->YAB1   --------->ANAC46   <----------DOF2     <---------AHL12(3)
----RVE1(2)   <---------ATHB12  <---------TOE2(3)  --------->TOE1(3)   <---------AHL20(3)
==========================================MADS_MADS--------->TOE2(3)   --------->AHL20(3)--------->GLK1(2)
 
aagagataatatgttcaaacattattcctctatataaggaatcaaacttgcaaactttaaaataaaattttgaaaaatatatctaatgtaatattctggt  6336400
                                                                                                 ---
                                                                                               -----
                                                                                               <----
                                                                                              <-----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                           <---------AHL12(1)-------
                                                                          --------->AHL20(3) <------
                                                                          --------->AHL12(1) <------
                                                                          --------->AHL25(2) -------
                                                                          <---------AHL20(3) -------
                                                                          <---------AHL25(2) -------
                                                                          <---------AHL12(2) <------
                                                                          --------->AHL12(2) -------
                                                             <---------AHL12(2)              -------
                                                            <---------AHL12(2)               <------
                                                          --------->AHL12(3)                <-------
                                                          --------->AHL20(2)                <-------
                                                          --------->AHL25(2)                --------
                 <---------ANAC55(2)                      --------->AHL25(1)         ----------->GT1
                 --------->ANAC55(2)                      <---------AHL20(3)       --------->MYB46(3)
       ----------->GT1                                    <---------AHL12(3)      -------->P--------
      --------->DAG2                                      --------->AHL20(3) <-----------GT1--------
     ---------->DOF2  --------->ZAT6     ---------->DOF2 --------->AHL12(2)--------->AHL12(1)<------
<---------YAB1 <-----------GT1      ---------->DOF2 ----------->GT1       <---------AHL12(1)--------
 
tttattagtaaagtaatattacttaatactaacaaattacaaagaaaagaactgaaggaaaaaaaataaacttttaaaattttctaaccagtgaaataaa  6336500
                             --------->YAB1
                             -------->HAHB4
                            <---------YAB1
                           <---------AHL12(2)
                          <---------AHL12(2)
                          --------->AHL12(2)
                          --------->YAB1
                         --------->AHL12(1)
                         --------->AHL20(2)
                         <---------AHL12(1)
                         <---------AHL20(2)
                         <---------AHL25(1)
                         --------->AHL25(1)
                       --------->AHL12(2)
                       <---------WOX13(2)
                     --------->AHL25(3)
                     --------->AHL20(2)
                     --------->AHL12(1)
                     <---------AHL25(1)
                     <---------AHL12(1)
                     <---------AHL20(2)
                     --------->AHL25(1)
                   <---------WOX13(2)
                   --------->WOX13(2)
                 <---------AHL25(2)
                 <---------AHL12(3)
                 <---------AHL20(3)
        --------->TOE2(3)<---------AHL25(3)
    <---------AHL25(3) --------->WOX13(2)
    <---------AHL20(2) <---------AHL12(2)
------>YAB1      --------->AHL20(3)
---->WOX13(2)    <---------AHL25(1)
-----WOX13(2)    --------->AHL25(3)
----AHL12(2)     --------->AHL25(2)
-->AHL20(1)      <---------AHL25(3)
---AHL20(3)      --------->AHL25(1)
---AHL20(1)      <---------AHL20(2)                                                     <---------AHL20(2)
---AHL25(1)      --------->AHL20(1)                                                     --------->KAN1
-->AHL25(2)      --------->AHL20(2)                                                     <---------AHL25(3)
---AHL25(2)     <---------AHL25(1)                                                     <---------AHL25(3)
---AHL25(3)     <---------AHL25(2)                                                     <---------AHL20(1)
-->AHL25(3)     --------->AHL25(2)                                                     --------->AHL12(1)
-->AHL25(1)     --------->AHL25(3)                                                     --------->AHL20(2)
-->AHL20(3)     --------->AHL25(1)                                                     --------->AHL20(3)
---AHL12(1)     --------->AHL20(2)                                                     <---------AHL20(3)
-->AHL20(2)     --------->AHL12(3)                                                     <---------AHL25(1)
-->AHL12(1)     <---------AHL12(3)                                                     <---------AHL12(1)
---AHL12(3)    --------->AHL12(2)                                                      <---------AHL25(2)
--AHL25(1)     <---------AHL12(2)                                                      --------->AHL25(3)
--AHL12(3)    --------->AHL12(1)                                             --------->YAB1
->AHL25(3)    <---------AHL12(1)                                        --------->ZAT18--------->AHL25(2)
->AHL25(1)    --------->AHL20(3)                                    --------->GATA12   --------->AHL25(1)
->AHL12(3)    <---------AHL20(3)   --------->YAB1                   <---------GATA12   --------->AHL20(1)
---AHL20(2)   <---------AHL25(2)  <---------YAB5                    <---------RVE1(2)  <---------AHL20(2)
->AHL20(2)    --------->AHL25(2)--------->YAB1                    ----------->ARR10  ------->TEIL  -
 
ttagaatttaaacttaaaattttattaattaataatagtcataacaaaatttgacaaatgttttcaacttagatgtgcaataaacatgaatttattctac  6336600
                                                                  <---------ANAC58
                                  <<<<<<<<<<<<<<<<<LFY            <---------ANAC58
                                  >>>>>>>>>>>>>>>>>LFY<----------DOF2
                                --------->RVE1(2)  --------->ARR11(3)
                          --------->ANAC58         <---------ARR11(3)
 <---------ICU4           --------->ANAC58  --------->KAN4(2)     --------->ANAC55(2)          -----
 --------->YAB5<---------YAB1  <---------KAN1     <---------CCA1(2)                     <------ZmHOX2a(2)
<---------ATHB12        <------NtERF2      --------->KAN1     <---------DAG2          <------ZmHOX2a(1)
-------->RVE1(2)      <---------ANAC46  <---------MYB46(3)    <---------DOF5.7(1)   <---------TOE2(3)
 
taaatcaatactgggcctatgaatggcgcaaggaatagcccattggttattctatatcttttggaccttacgtttttgaagcctgtttaggatcacactc  6336700
                                                                             ----------->GT1
                                                                       ------>ZmHOX2a(2)
                                                                      <------ZmHOX2a(2)
                                                                     <---------ARR11(2)
                   <-----------GT1                                   <---------GATA12
                  <---------KAN1                                  ------>ZmHOX2a(2)
                <---------ICU4                                   --------->CCA1(2)
             --------->YAB1                                      --------->ARR14(1)
          <---------AHL12(2)                                    --------->GATA12
         --------->AHL20(2)                                     <---------ARR11(2)
        --------->AHL12(1)                                      --------->ARR11(2)
        <---------AHL12(1)                                      <---------ARR14(2)
        <---------AHL20(2)                                      --------->ARR14(2)
        --------->AHL20(2)                                      --------->ARR11(1)
        --------->AHL12(3)                                      --------->ARR11(3)
        --------->AHL25(1)                                      <---------ARR11(3)
        --------->AHL25(3)                                      <---------GATA12
        <---------AHL25(1)                                      --------->RVE1(2)
        <---------AHL12(3)                                     <---------GLK1(1)
       <---------AHL12(2)                        --------->ARR11(2)  --------->GATA12
       --------->AHL12(2)                        <---------ARR14(2)  --------->ARR11(2)
      <---------AHL12(2)                         --------->ARR14(2)  --------->ARR14(2)
    --------->AHL25(1)                        <---------KAN1<---------At4g35610
    <---------AHL20(3)                   *TSS<---------TOE2(3) <---------HSFB2a(1) <---------AHL12(1)
    --------->AHL20(2)           --------->YAB5  <---------ARR11(2)  <---------ARR14(2)
    --------->AHL20(3)        --------->AtMYB61  ------->TEIL ----------->ARR10    --------->AHL12(1)
---->YAB1<---------AHL25(3)  --------->MYB46(3) <---------CCA1(2)<------ZmHOX2a(2)--------->ICU4   -
 
ataacaaaaaaataaataagaattacgcttctaccaccattaaactctaatgtatctgaactcagaagatccgatcggagtagtaaaaattcaacaaaac  6336800
                             --------->ARR14(2)
                             <---------ARR14(2)
                             --------->ARR11(2)
                             <---------GLK1(2)
                             --------->GATA12                      --------->ARR11(2)
                             <---------ARR11(2)       <---------GLK1(2)
                             <---------GATA12       --------->ANAC46           <---------ANAC46
              --------->AHL20(2)                    --------->LBD16<---------ARR11(2)
              <---------AHL20(2)                   --------->HSFB2a(2)         <---------ANAC58
           --------->YAB5 <---------TOE1(2) <-----------GT1        --------->RVE1(2)
  --------->YAB1   --------->KAN1        <---------GLK1(1)--------------------->WRI1     <---------LBD16
-------->YAB1 <---------AHL25(1)     >>>>>>>>>TBF1 <---------HSFB2a(2)         <---------ANAC58 ----
 
aacaataagaaaactcattaattcattcgtcggattcgaagaagaaatcacttcccagaaactttcttcgtatcgaagtattgcttgtgttcttcggaga  6336900
               <---------KAN1
              <---------ARR14(2)
              --------->ARR14(2)
              <---------ARR11(2)
          ------>ZmHOX2a(2)
         <------ZmHOX2a(2)
        <---------ARR14(2)
        <---------ARR11(2)                     ------>ZmHOX2a(2)
        <---------GATA12                       ================================HOX2a_HOX2a
        --------->GATA12                       ====================================HOX2a_HOX2a
        --------->ARR14(2)                     ==========================HOX2a_HOX2a
        --------->ARR11(2)                   <---------ARR14(2)
    ------>ZmHOX2a(2)                        --------->ARR11(2)
    <---------LBD16                          <---------ARR11(2)                   <<<<<<<<<TBF1
   <------ZmHOX2a(2)                         --------->ARR14(2)              <---------DOF5.7(1)
  <---------ARR11(2)                         <---------GATA12               ------>ZmHOX2a(1)
  <---------ARR14(2)            --------->ARR14(2)                    <---------DOF5.7(1)
  --------->GATA12              <---------ARR11(2)    ----------->GT1------>ZmHOX2a(1)
  --------->ARR14(2)            --------->ARR11(2)  --------->DOF5.7(1) ------>ZmHOX2a(1)
  <---------GATA12           <---------TOE2(3) =============================HOX2a_HOX2a       ------
  --------->ARR11(2)  <---------ZAT14        --------->GATA12       <---------ALFIN1    <<<<<<<<<TBF1
----->CCA1(2) --------->ARR11(2)<---------ARR14(2)---------->DOF2 ------>ZmHOX2a(1)  <<<<<<<<<TBF1
 
aacgagatcgggatccgaatacgagtacaatggaggtttcgcaagatggatcggaaagagataaaactcctcctccttcctcttcttcttcttcttcctc  6337000
                     --------->HSFB2a(2)
                     <---------HSFB2a(2)
                     <---------HSFC1(1)
                     --------->HSFC1(1)
         <-----------HVH21
         <-----------TGA1
        <---------ETT(2)
        --------->ETT(2)
        <---------TGA2(1) --------->DOF5.7(1)                                           <------ZmHOX2a(1)
        <---------bZIP60(1)                                                           <---------TOE2(3)
        --------->bZIP60(1)    --------->MYB52(2)--------->STY1(2)                --------->ZAT2
        --------->TGA2(1) --------->DAG2 <---------KAN1                           <---------ZAT2
     ------>ZmHOX2a(1)  ---------->DOF2<---------GLK1(2)                          <---------At4g35610
>ZmHOX2a(1)         <---------LBD16    <---------RVE1(2)  <---------YAB5          --------->At4g35610
 
tcccattcctgtcgtcaccaatttctggaaaggtttgtttcagattatgtctagctatctattcgttttcttcgactcgtagtgaagctgaggatgagct  6337100
                                  <---------ANAC58
                                  <---------ANAC46
                                  <---------ANAC58                     --------->KAN1
                              <---------GLK1(1)                        <---------KAN4(1)
                              <---------ARR14(2)                       <---------KAN1
                         <<<<<<<<<MYB98                     --------->GLK1(2)
                       <---------MYB46(3)                  <---------GLK1(2) --------->LBD16
                       --------->MYB52(2)                  <---------RVE1(2)--------->HSFB2a(2)
                     <---------MYB52(1)                    --------->GATA12 <---------HSFB2a(2)
                  <-------TEIL--------->ARR14(2)         ----------->ARR10  <---------LBD16        <
               --------->KAN1<------ZmHOX2a(1)        --------->WOX13(2)   <---------LBD16  <-------
           <------ZmHOX2a(1)<---------YAB1            <---------WOX13(2)--------->KAN4(2)<---------AtMYB61
 
tgtttttgtagttaggagaaattcgtttgttaggattccgtttaagtagtaagacttaatgagattctcactgaatgttcggggagattgcattggtagt  6337200
<- Previous    Next ->

AGI:  At3g18480.1   
Description:  CCAAT displacement protein-related / CDP-related. Identical to Protein CASP (CASP) [Arabidopsis Thaliana] (GB:Q9LS42;GB:Q93ZW7); similar to ZWI (ZWICHEL), calmodulin binding / microtubule motor [Arabidopsis thaliana] (TAIR:AT5G65930.2); similar to ZWI (ZWICHEL), calmodulin binding / microtubule motor [Arabidopsis thaliana] (TAIR:AT5G65930.1); similar to expressed protein [Oryza sativa (japonica cultivar-group)] (GB:ABF98508.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68029.1); similar to CASP C terminal, putative [Oryza sativa (japonica cultivar-group)] (GB:AAX95655.1); contains InterPro domain CASP, C-terminal; (InterPro:I
Range:  from: 6336742    to: 6341794    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version