AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                              <---------MYB46(3)
                              <---------DEAR3(2)
                             <---------DEAR3(1)
                             <---------TOE1(2)
                             <---------TOE2(2)
                         <---------YAB5
                      --------->KAN1
                     <---------AHL12(1)
                     --------->AHL25(3)
                     --------->AHL25(1)
                     --------->AHL20(2)
                     --------->AHL20(3)
                     <---------AHL20(3)
                     <---------AHL20(1)
                     --------->AHL20(1)
                     --------->ARR11(3)
                     <---------ARR11(3)                                             --------->AHL25(2)
      <---------YAB1 --------->AHL12(1)                                             <---------AHL25(2)
      --------->ICU4 <---------AHL20(2)                                             --------->AHL12(1)
      <---------YAB5 --------->AHL25(2)                                             <---------AHL20(2)
    --------->YAB1   <---------AHL25(1)                                    <------ZmHOX2a(1)
   <-------TEIL      <---------AHL25(2)                                    <---------PCF5 <---------RVE1(2)
---------YAB1        <---------AHL25(3) <---------MYB46(3)              <------ZmHOX2a(1)--------->ATHB12
-------DOF2     <---------AHL20(2)  <---------AHL20(2)          <---------ZAT6      --------->AHL20(2)
-----GT1        --------->AHL20(2) --------->AHL25(3)      --------->TOE2(3)        <---------AHL12(1)
 
ttttgattcatgattttgttttaatatattcgtcggtttttatttgttgaaatatgacattacattagcgttataggaggaccacaattttttgatttga  4996100
                   <---------At4g35610
             <---------ICU4
             <--------ATHB1
             -------->HAHB4
             <---------AHL25(3)
             --------->AHL12(1)
             <---------AHL12(1)
             --------->YAB5
            <---------YAB1
            <---------YAB5
            <---------ATHB51
            --------->ICU4
           --------->AHL20(3)
           <---------AHL20(3)
           <---------AHL12(3)                                  --------->ANAC58
           --------->AHL12(3)                       --------->WOX13(2)
           --------->AHL25(2)                      --------->YAB5
           <---------AHL25(2)                      <---------ICU4
           <---------AHL12(2)                     <---------YAB1 ---------->DOF2
           --------->AHL12(2)                     --------->AHL20(2)
          --------->YAB5                     <-------TEIL      --------->ANAC58
          --------->YAB1                  <------MYB83<---------AHL20(2)
         <---------ATHB12                 <------MYB46(1)<---------DAG2
         <---------ATHB51       --------->ARR11(3)<---------AHL20(2)
         --------->ICU4         <---------ARR11(3)--------->AHL25(3)
    --------->ANAC46           <---------GLK1(1)  <---------AHL25(1)                 <---------RVE1(2)
    --------->ANAC58           --------->GLK1(1)  --------->AHL25(1)                 <---------ARR11(3)
    --------->ANAC58   <---------ZAT6--------->ATHB12 <-----------GT1                --------->ARR11(3)
--------->CCA1(2)  --------->At4g35610<---------RVE1(2)  <----------DOF2     --------->YAB5
 
aagataaacgcaataataattcagcagtgtgaagaaatcttgatttggttcatataattacttttcaagaaagttgaaaatgtttagagatattgttttt  4996200
                                                                       --------->ICU4
                                   --------->YAB1                      <---------YAB1
                              --------->MYB46(3)                <---------ANAC58
                             --------->ANAC58         <---------AHL12(3)
                             -------->P               --------->AHL20(3)
                             --------->ANAC58         --------->AHL12(3)                  --------->GLK1(2)
                     <---------ANAC58                 --------->AHL20(2)                  --------->GATA12
                     <---------ANAC58    --------->DOF5.7(1)    <---------ANAC58  <---------ANAC46
          --------->DAG2  --------->At4g35610         <---------AHL20(2)        ----------->GT1   <-
         ---------->DOF2  <---------At4g35610         <---------AHL25(1) --------->WOX13(2) --------
      <---------WOX13(2)--------->ZAT18---------->DOF2<---------AHL20(3) <---------WOX13(2)<--------
 ----------->GT1<----------DOF2   <---------ATHB12    --------->AHL25(1)--------->ATHB51 <---------GLK1(2)
 
gtgtttgtaaaataaagcacttttgagtgagcaaccaatgagaaaagagaatgctatttatatagttgtttgctataattgaatggtgtttagaatctcc  4996300
                                                                              <------------CBF
                                                                           ------>NtERF2
                                                                          --------->DREB2C(2)
                                                                          --------->RRTF1(3)
                                                                          --------->RAP2.3(3)
                                                                          --------->RRTF1(2)
                                                                          --------->RAP2.3(2)
                                                                          <---------ATERF1(2)
                                                          --------->O2   --------->ORA47(2)
                                                          <---------ANAC58--------->DEAR3(1)
                                                          <---------ANAC46--------->RAP2.6(2)
                                                          <---------ANAC58--------->ATERF1(2)
                                                          <---------TGA1a--------->RAP2.3(1)
                                                          --------->TGA1a--------->RAP2.6(1)
                                                     <------ZmHOX2a(2)   <------NtERF2
                                                    --------->TCP20--------->KAN1
                                                    <---------GATA12     --------->RRTF1(1)
                                                    --------->GATA12     --------->DEAR4(2)
                                                    <---------ARR11(2)   --------->ERF1           --
                                                    <---------RVE1(2)--------->ANAC46             --
                                                    --------->TCP16(1)  ------>NtERF2             <-
                                                    --------->ARR14(2)------->MYC2                <-
                                                    --------->ARR11(2)------->MYC3                <-
                                                  <---------MYB46(3) --------->ANAC58             <-
                                            <---------O2  <---------O2<-------MYC2               ---
                                     --------->KAN1 <---------ARR14(2)<-------MYC3  <---------RVE1(2)
                              <-----------GT1 --------->ALFIN1--------->MYB52(2)  <---------TOE2(3)
     --------->ANAC58        ---------->ID1 --------->O2--------->LBD16 <---------ATERF1(1)      ---
     --------->ANAC58<----------DOF2--------->ARR14(2)<---------LBD16--------->ANAC58           ----
--------ICU4         <---------DAG2 <---------ARR11(3)------>ZmHOX2a(2)--------->ANAC46        -----
->RVE1(2)          ------->TEIL     <---------ARR14(2)--------->ATERF1(1)--------->ATERF1(1)  ------
-KAN1--------->ANAC46===============================================bZIP_DOF<------NtERF2<------ZmHOX2a(1)
 
aaaattgcacgagatgaaaacgaactttttttgtcacaatatatgccaagtggtggatccggcgtgagttacacgcgccgccattgagattaggacagcc  4996400
                                                                     --------->ARR14(2)
------>MYB83                                                         --------->ARR11(2)
------>MYB46(1)                                                      <---------ARR14(2)
------->AtMYB61                                                      <---------ARR11(2)
------->MYB46(3)                                                   --------->HSFC1(2)
--------MYB111(1)                                                  <---------HSFC1(2)
--------MYB55(2)                    --------->TGA1a                <---------MYB46(3)
--------MYB111(2)                   <---------TGA1a      <---------ARR11(1)
--------MYB46(2)                  <---------ALFIN1       --------->GATA12       ------>ZmHOX2a(1)
------>ANAC58                   ----------->RAV1(1)   *TSS         --------->HSFB2a(1)
------>ANAC58                   <---------ALFIN1--------->At5g28300<---------DEAR3(2)         ------
-->NtERF2------>ZmHOX2a(1)     --------->ANAC46----------->GT1    <---------DEAR3(1)        <-------
---->RAP2.6(2)          --------->KAN1  <---------ANAC46<---------CCA1(2)     ----------->RAV1(2)
--->MYB46(3)           <---------AHL25(3)  <---------PCF2--------->ARR11(3)  ------>ZmHOX2a(1)<-----
 
accaaactcttcctcataagaagacataaattcccccacacttgtggggacagtaactcaaatctttcgacggttctgtcctcctgtttcttaagttaat  4996500
                 ---------->DOF2
           ------->GAMYB
           --------->At1g77200
           --------->DEAR3(1)
           --------->DEAR4(1)
           --------->DREB2C(2)
          --------->MYB46(3)
          <------NtERF2
         ------>NtERF2   ------>NtERF2                                                             -
     --------->ANAC46   --------->DEAR3(1)                                                         -
     --------->ANAC58   <---------ALFIN1                                                           <
     --------->ANAC58--------->ANAC58                                                              <
   <---------ANAC58  --------->ANAC58                                                      ---------
   <---------ANAC58  --------->ANAC46         <---------TOE1(2)                           --------->YAB5
--->WOX13(2)----------->RAV1(1)              >>>>>>>ZML2                         --------->DOF5.7(1)
--AHL20(2)--------->DEAR3(2) <---------MYB52(1)   <-------TEIL                  --------->MYB52(1) -
----WOX13(2)<---------DDF1<------NtERF2 <---------MYB46(3)                     ---------->DOF2 <----
 
ttcaatgcatgccaccgacataaaacgccaccgtttatattgtttgttctaggttcaatggattgcagtttttgaagaaaaacaaagggaagaagattat  4996600
                                                                                            --------
                                                                                        --------->ANAC58
                                                                                        --------->ANAC58
       <---------RVE1(2)                                                                --------->ANAC46
      --------->KAN1                                                                  <-------------
   <------MYB83                              ------->TEIL                             ------->GAMYB
   <------MYB46(1)                        <---------KAN1                             --------->MYB46(3)
<-------GAMYB                           <---------AtLEC2                           <-----------GT1
-------->MYB55(2)                       <---------ANAC58                        <----------DOF2
-------->MYB52(2)                 <---------MYB46(3)                        --------->ARR14(2)
-----------RAV1(1)                --------->ATHB12                          <---------ARR14(2)
---------MYB46(3)                <---------ATHB12                           --------->ARR11(2)
>ARR11(3)                        <---------YAB5    --------->KAN1        <---------ANAC46   --------
-------->MYB111(2)     <---------ATHB12 <---------ANAC46          --------->KAN1--------->TOE2(3)
-----YAB1             --------->RVE1(2) <---------ANAC58 ------>ZmHOX2a(1)  <---------ARR11(2)  ----
 
gtttgttggtgattctcttagtctaaatcaatggcaatcgttggcatgtatgcttcattcctctgttccaaattctacgtatactttaaccacacaaggt  4996700
                                     <---------ARR14(2)
                                     <---------ARR11(1)
                                     --------->RVE1(2)
                                     <---------GATA12
                                     --------->GATA12
                                     --------->ARR14(2)
                       <-------GAMYB <-----------ARR10
                      --------->MYB111(1)
                      --------->MYB111(2)
                      --------->MYB52(2)
          <---------ALFIN1          ------>MYB46(1)
     ------->TEIL     --------->MYB46(2)                                                       -----
 --------->RVE1(2)<---------TOE2(3) ------>MYB83      <<<<<<<<<<WRKY43                       -------
->ANAC58 ------>MYB46(1)          <---------MYB59     <<<<<<<<<<WRKY38                      --------
--AGL15--------->AtMYB61       <-----------GT1        <<<<<<<<<<WRKY26  <---------LBD16     <-------
->ANAC58 ------>MYB83 <---------MYB46(3)              --------->WRKY18(1)--------->LBD16--------->LBD16
------->GT1 --------->KAN1 <---------YAB1 <---------ALFIN1             <---------LBD16<---------LBD16
 
agtatatcaacctacacattcaaggtagttgttattaccaaatctacacttgttttggtcaagttgaatagaaaaccgggatgaactaaaccggagtggt  4996800
                                                                      --------->ARR14(2)
                                                                     --------->ATHB12
       <------ZmHOX2a(1)                                            ----------->ARR10
    <-----------RAV1(2)                 --------->YAB5       --------->MYB59
------>GT1                             --------->ICU4 --------->CCA1(2)
---->GT1                               <---------KAN1<---------ARR11(3)                           <-
->ALFIN1                            <------ZmHOX2a(1)<---------RVE1(2)<---------ARR14(2)   ---------
--AtMYB61 <---------KAN1       --------->ATHB12      --------->ARR11(3)                    ---------
 
gaaaattgcaggagtatggactggaattgaagcttgataggaatgtttatctagtagatatagttagggagaagattgggagagttttgaagcttgattc  4996900
           --------->AHL12(1)
           --------->AHL25(2)
           <---------AHL25(2)                                                               --------
           <---------AHL25(1)                                                               --------
           --------->AHL25(1)                                                            <-------TEIL
           <---------AHL12(1)                                                        <-------TEIL
           <---------AHL20(2)                                                        --------->SPL7(1)
   --------->ATHB12         --------->ARR11(2)                                       <---------TOE1(2)
   <--------ATHB1           <---------ARR11(2)                                     <---------SPL7(1)
   --------->YAB1         ----------->GT1                                         ------->GAMYB
  <---------ATHB12  ----------->ARR10                  <---------MYB46(3) ------>ZmHOX2a(1) --------
  --------->ICU4 <---------ANAC46       --------->AHL20(2)          <---------AtMYB61------->TEIL
-----ZmHOX2a(2) --------->MYB59     <---------RVE1(2) <---------AtMYB61   --------->AtLEC2  --------
>KAN1 ----------->GT1 <---------RVE1(2)--------->AHL12(2)        <------NtERF2--------->MYB46(3)
>ATHB12    <---------AHL20(3) <-------TEIL           <XXXXXXXXXXXXXXXXXXXXXMIR472--------------->AtSPL3
 
gatcaatgatggaaaaaattgggtagagatggatacattgatttttaatacttggcattggtggagtcggagaggtcctgcacaaccgtacgttcaagta  4997000
<- Previous    Next ->

AGI:  At3g14850.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G29050.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39470.1); contains InterPro domain Protein of unknown function DUF231, plant (InterPro:IPR004253)
Range:  from: 4996455    to: 4997700    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version