AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   --------->YAB1                 --------->AHL25(1)
                --------->WOX13(1)               --------->AHL25(3)
               --------->YAB5                    <---------YAB5
              <---------KAN1                     <---------YAB1
              --------->ICU4                     --------->ICU4                <---------ARR14(2)
       <---------ANAC58                         --------->AHL12(2)       --------->DAG2
       <---------ANAC58                         <---------AHL12(2)       --------->DOF5.7(1)
       <---------ANAC46                       --------->AHL20(2)        --------->DOF5.7(1)
  <---------WOX13(2)                        ----------->GT1             ---------->DOF2
  --------->WOX13(2)                      ---------->DOF2          --------->AHL25(1)
----ARR11(3)  <---------ATHB12   <---------------AGL15             --------->AHL20(2) ---------->DOF2
--->ARR11(3)  <---------YAB5    ----------------->AGL1         --------->ICU4  --------->ARR14(2)
ctttcaatttgagtggaatcattcaaaacttgattcccctaacttgaaagtaattatttgaatgtaagaattaaaaaaagcgtattttgtaaagtatcac  3758100
                                                         --------->HSFC1(1)     --------->AHL25(2)
                                                         <---------HSFC1(1)     <---------AHL25(1)
                                                        <---------ANAC46        --------->AHL25(1)
                                            --------->AHL25(3)                  --------->AHL25(3)
                                            <---------AHL25(2)                  <---------AHL20(1)
                          --------->YAB1    --------->AHL25(2)                  --------->AHL20(2)
                       --------->TOE2(3)    --------->AHL25(1)                  <---------AHL20(2)
               ----------->GT1              <---------AHL20(2)         <---------AHL12(2)  <--------
           <---------WOX13(2)               --------->AHL12(3)----------->GT1   --------->AHL20(3)
    --------->KAN1     --------->TOE1(3) --------->AHL20(1) ---------->DOF2     <---------AHL25(2)<-
gactaaaacatgctagttgagttaaaccttcataaaaaatgaaacatattatttgagtttcgagaaagaaaaaaaaaaaacattttatttgagttgtcgc  3758200
                <-----------------AGL3   --------->AHL12(2)
             ------->TEIL              --------->ATHB51                                           <-
            <-----------GT1        <---------YAB1                                                 --
     --------->YAB1              --------->YAB1                 --------->YAB1                    <-
    <------ZmHOX2a(2)          <---------WOX13(2)     --------->MYB46(3)                    <-------
---HVH21 --------------->AtSPL8--------->WOX13(2) <---------ATHB12                      ---------->DOF2
--------ARR14(2)----------------->AGL3 --------->AHL20(2)--------->MYB46(3)    <---------AHL20(2) <-
agacacgatcacgatgtaccctatatatagttccaattagcattatttatcccatcaacaacaactattatgtcagaaatattgaattagtaaaagaaac  3758300
                                                         --------->ANAC58             --------->ANAC58
                                                         --------->ANAC46             --------->ANAC55(1)
                                                         --------->ANAC58             --------->ANAC55(2)
                                                        <-------PIF5                  <---------ANAC55(2)
                                                        ------->PIF5                  --------->ANAC46
                                                        ------->MYC2                  <<<<<<<<<<HY5
                                                        <-------MYC2                  <---------TGA1a
                                                        <-------MYC3                  --------->bZIP60(2)
                                                        ------->MYC3                  <---------bZIP60(1)
                                                       --------->ANAC58               --------->bZIP60(1)
                                                       --------->ANAC58              <-----------STF1
                                                   <------MYB46(1)                  <---------ALFIN1
                                                   <------MYB83                    <------NtERF2
                                                  --------->MYB46(2)             --------->ALFIN1
                                              --------->ALFIN1                 <---------ANAC58
    ----------->RAV1(2)                     <---------ANAC46             ----------------------->TaNAC69(2)
--------GATA12                              <---------ANAC58   <---------GATA12<---------ANAC58 <---
------->RVE1(2)                             <---------ANAC58   --------->GATA12<---------At4g35610
--------ARR11(3)                    ------->TEIL  --------->MYB59   <---------------AtSPL8  <-------
---ID1                         --------->MYB52(1)===============================================MYC_MYB
----------ARR10             <<<<<<<<<<<<<<<<<LFY <--------P <-----------RAV1(2)--------->At4g35610<-
aaatcttatctgggccatccatttgcacacagaccaatggacgtagagcgtggtaggcacgagccagatgtgaggtaccttgaggtgccacgtcacattg  3758400
                                        <---------DREB2C(1)                                       <-
                                        --------->DREB2C(1)                                       <-
                                        ------>NtERF2                                             --
                                        <------NtERF2                                            <--
                                        --------->ATERF1(1)                                      ---
                                        <---------ATERF1(1)                                      <--
                                       <---------ERF1                                           ----
                                       <---------SPL7(1)                                        ----
                                       <---------RAP2.3(1)                                      <---
                                       <---------ATERF1(1)                                      ----
                                       ------>NtERF2 <---------SPL7(1)                          <---
                                      <---------DEAR3(1)                                        <---
                                      <---------RAP2.3(2)                                       ----
          <------NtERF2               <---------ATERF1(2)                                       <---
         --------->LBD16              <---------ANAC58 <---------TOE1(2)                        ----
        <---------ANAC58              --------->ATERF1(2)                                       <---
        <---------ANAC46              <---------RAP2.3(3)                                       ----
       <---------LBD16                <---------ANAC58 --------->SPL7(1)                        <---
       <<<<<<<<<E2Fc                  <---------RAP2.6(2)                                       ----
       <<<<<<<<<E2Fd                  <---------RRTF1(3)   --------->ARR11(2)                  -----
   <----------DOF2                    <---------DREB2C(2)*TSS                                  -----
  --------->ATHB12                    <---------RRTF1(2)--------->ANAC58                       -----
 <---------YAB5                      --------->RAP2.6(3)--------->ANAC58                       <----
 <---------HSFB2a(1)            --------->DOF5.7(1) <---------ANAC58                           -----
 <---------KAN1                <---------AHL20(2)   <---------ANAC58                           <----
--------->GLK1(2)              --------->AHL20(3)   <---------ANAC46                   <---------MYB52(2)
==============bZIP_DOF         <---------AHL20(3)  --------------->AtSPL3 ----------->GT1      <----
------TOE2(3)                 --------->YAB1       <---------------AtSPL3 --------->YAB1       -----
-----CBF<---------ANAC58     ----------->TBP ---------->DOF2      --------->YAB5 <------------------
-----ZmHOX2a(1)  <------------CBF<---------ICU4    --------------->AtSPL8<---------ATHB12  ---------
aggaatctttggcggggtttcattgtttacctataaaaatggcggccgcaaagtttcgtacgtctccgatgtttcaatcgtgaaatcgaaacaaacaaaa  3758500
--------AHL12(2)                                      ----------->GT1
--------WOX13(2)                                   --------->MYB52(1)                    <---------SPL7(1)
------->WOX13(2)                                  ------>NtERF2                          ------>NtERF2
-------ICU4                                       <---------SPL7(1)                     --------->RAP2.3(3)
------>YAB5                                      --------->DEAR3(1)                    --------->ORA47(2)
-------AHL25(3)                                  --------->MYB46(3)                   --------->LBD16
----->AHL25(1)                                 <---------ATERF1(1)                    <---------ATERF1(1)
----->AHL12(3)                                 ------>NtERF2                         --------->DEAR3(1)
------AHL12(3)                                --------->DEAR3(1)                     --------->ANAC46
----->AHL25(2)                                <---------DEAR3(1)                    <---------LBD16
------AHL25(1)                               --------->RAP2.3(1)                --------->RVE1(2)
------AHL20(2)                               <------NtERF2                      <-----------ARR10
----->AHL20(2)                               --------->ATERF1(1)                --------->ARR11(3)
------AHL25(3)                              <---------ATERF1(1)                 --------->GATA12
----->AHL25(3)                              ------>NtERF2                    --------->AHL25(2)
------AHL12(1)                              <---------RAP2.3(1)              <---------AHL25(2)
----->AHL12(1)                             <---------RAP2.3(3)               <---------AHL25(3)
------ATHB51                               <---------ATERF1(2)               <---------AHL20(3)
----->ICU4                                --------->SPL7(1)                  <---------AHL25(1)
---->AHL12(2)                             --------->RAP2.6(3)                --------->AHL25(1)
---->AHL20(3)                            --------->MYB52(1)                  --------->AHL20(2)
---->AHL25(3)                  <------ZmHOX2a(2)<------NtERF2                <---------AHL20(2)
-----AHL25(2)            <---------DEAR3(1)--------->ATERF1(2)               --------->AHL20(3)
---->AHL25(2)      <---------DEAR3(1)   ----------->HVH21   <-------TEIL   --------->WOX13(2)
-----AHL20(3)     <------ZmHOX2a(1)     ----------->TGA1 <---------MYB46(3)<---------WOX13(2)    ---
-----AHL20(1)     ====================HOX2a_HOX2a----------->HVH21     <----------DOF2------>NtERF2-
---->AHL20(2) --------->DOF5.7(1)---------->DOF2--------->ATERF1(1)   --------->TOE2(3)--------->RAP2.3(1)
---WRI1----------->GT1  --------->ATERF1(1)<---------DEAR3(1)  <---------CCA1(2)<---------ARR11(3) -
>YAB1---------->DOF2 <------NtERF2   <---------ARR11(3)<---------MYB52(1) --------->YAB1--------->DEAR3(1)
taattaaaaaaagaaataagaggaggcgatggcgatcaaagacctgacggcgacgaccggtgattcatctcttcctttaataaaatctccgccgtctgaa  3758600
     <---------MYB46(3)                                                                      -------
     <---------ATERF1(1)                                                ------>ZmHOX2a(1)   <-------
    <---------DEAR3(1)                                               <------NtERF2         <--------
   <---------ABI4(1)                                               <---------ANAC58  --------->ANAC58
 --------->DEAR3(1)                                                <---------ANAC58  --------->ANAC58
 ------->GAMYB                                                 <-----------RAV1(2)   <---------ANAC55(2)
--------->MYB46(3)                                            <-------TEIL           --------->ANAC55(2)
--------->DEAR3(2)                                            --------->ZAT14     ------>ZmHOX2a(1)
------>MYB46(3)                     --------->At5g28300    <---------DEAR3(2)     <---------SPL7(1)<
------->P    <---------ARR14(2)    ----------->GT1        <---------TOE1(2)      <---------ANAC58 --
-------->MYB52(1)   <---------At4g35610  --------->TOE2(3)<---------DEAR3(1)     <---------ANAC58---
acaaccggcggtgacagaacctctgctcttcaaacgctcggtaacattatcgtctccatcgtcggtacaggcgtccttggtcttccttacgcattccgca  3758700
    <---------AtMYB61                     --------->ANAC46
    <---------MYB46(3)                    --------->ANAC58
   <--------P <---------ARR14(1)       <---------ARR14(2)
   <---------MYB52(1)                  --------->ARR11(2)
   <---------MYB55(1)                  --------->ARR14(2)
  <---------MYB52(1)                   <---------ARR11(2)
  <-------GAMYB<---------ARR11(1)      <---------GLK1(2)                                     -------
 <---------MYB46(3)                    <---------RVE1(2)                                     -------
 <---------DEAR3(2)                    <---------GATA12                                   <---------ARR14(2)
<---------DEAR3(1)                     --------->GATA12                          <---------DAG2   <-
-->LBD16     --------->LBD16 --------->ICU4                                      <----------DOF2  --
--ANAC55(2)<---------LBD16   <---------YAB1  <---------ALFIN1                    <---------DOF5.7(1)
-LBD16<-------GAMYB          <---------YAB5  --------->DEAR3(1)        <---------MYB52(1) --------->RVE1(2)
---------LBD16<---------CCA1(2)     <---------TOE1(2)               ------>ZmHOX2a(1)     --------->ARR14(2)
---------->AtMYB77        <---------YAB5  --------->ANAC58       ------>ZmHOX2a(1)<---------DOF5.7(1)
------>DEAR3(1)<---------GATA12 <---------YAB5------>NtERF2     <---------ALFIN1<---------DAG2------
tcgccggttggttagccggatctctcggtgtcattatcgtcggattcgccacctattactgcatgctcctcctcgttagtatacctttttccaaatcctt  3758800
          --------->AHL12(1)                                                        --------->CCA1(2)
         <---------AHL12(2)                                                        <---------RVE1(2)
         --------->AHL12(2)                                             <-------TEIL--------->KAN1
        --------->AHL12(2)                                             --------->GLK1(2)
      <---------YAB1                                                  --------->ARR14(2)
      --------->AHL25(3)                                   --------->AHL20(2)<---------ZAT14
  <---------ANAC46                                         <---------AHL20(2)--------->ZAT14
-->TOE2(3)--------->AHL25(3)                           ----------->GT1<---------GATA12--------->ANAC58
-->TOE1(3)<---------AHL25(2)                         <---------RVE1(2)--------->GATA12--------->ANAC58
--------WOX13(2)                                <---------WOX13(2)    <---------ARR14(2)
------->WOX13(2)          <---------ATHB12      --------->WOX13(2)    <---------ARR11(2)     -------
>ZmHOX2a(1)--------->ATHB12                   <---------YAB1          --------->ARR11(2)    <-------
aaattgagtataatttattgacttctccaatcgacttcaacaacgtaatctaattggattgttttaatatgcagattcagtgcagagataagctagaatc  3758900
                                                                       --------->MYB52(1)          <
                                                                    --------->ANAC55(2)        <----
                                                           --------->DOF5.7(1)<---------KAN1   =====
                                                           --------->DAG2 <---------MYB59    <------
    <------ZmHOX2a(1)              <---------TOE2(3)     ---------->DOF2  ------->GAMYB      -------
-->GLK1(2)    --------->GLK1(2)    --------->MYB59----------->GT1<---------ARR11(2)          -------
--GLK1(2) >>>>>>>>>TBF1            <---------TOE1(3)<----------ID1  <---------ANAC55(2)  <----------
ggaagaaggagaagaagaatcgaaaacttatggtgatttaggtttcaaatgtatgggaacaaaaggtcgatacttaaccgaattcctcattttcactgct  3759000
<- Previous    Next ->

AGI:  At3g11900.1   
Description:  ANT1 (AROMATIC AND NEUTRAL TRANSPORTER 1); amino acid transmembrane transporter. similar to amino acid transporter family protein [Arabidopsis thaliana] (TAIR:AT4G38250.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45282.1); contains InterPro domain Amino acid transporter, transmembrane (InterPro:IPR013057)
Range:  from: 3758458    to: 3760384    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version