AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->TGA2(2)
                        <-----------HVH21
                        <-----------TGA1
                       --------->ANAC58
                       --------->ANAC55(2)
                       <---------ANAC55(2)
                       --------->TGA1a                                                         -----
                       --------->bZIP60(2)                                                    ------
                       --------->bZIP60(1)                                                   <------
                       --------->ANAC46                                                     ------>ZmHOX2a(2)
                       <---------bZIP60(1)                                                  ========
                       <---------TGA1a                              ------>ZmHOX2a(2)       <-------
                       --------->O2                                <---------GLK1(1)       =========
                       --------->ANAC58                            --------->GLK1(1)       <------ZmHOX2a(2)
                       <---------O2                                <------ZmHOX2a(2)      <---------ARR11(2)
                      <-----------STF1                            <-----------ARR10       --------->ARR14(2)
                      ------>NtERF2                               <---------GATA12        <---------ARR14(2)
                      <-----------bZIP910(1)                      --------->GATA12        --------->GATA12
                   <-----------HVH21                              <---------ARR14(2)      --------->ARR11(2)
                  --------->ANAC58                                <---------ARR11(3)      <---------GATA12
                  ===============MYC_MYB                          --------->ARR11(2)      <---------RVE1(2)
                  ------->GAMYB                                   <---------ARR11(2)      --------->TCP16(1)
                  --------->ANAC58                                --------->ARR14(2)    <---------MYB46(3)
                  --------->ANAC46                                --------->ARR11(3)    --------->ABI4(2)
                  --------->DEAR3(1)                             <------ZmHOX2a(1)     --------->ALFIN1
                  --------->RAP2.6(2)                            =================================HOX2a_HOX2a
                 --------->MYB46(3)                           --------->YAB1        <---------DEAR3(1)
                 --------->DEAR3(2)                          --------->ICU4  --------->MYB46(3)<----
                 ================MYC_MYB                    --------->WOX13(2)      <---------ATERF1(2)
                 <---------MYB55(2)                         <---------WOX13(2)     <---------LBD16<-
   ==============================bZIP_DOF                 --------->ICU4------>ZmHOX2a(1) --------->TCP20
   <----------DOF2--------->DREB2C(2)               =======================HOX2a_HOX2a<---------MYB52(1)
 <---------DOF5.7(1) <---------ALFIN1               ------>ZmHOX2a(1)   ===========================HOX2a_HOX2a
------>AtMYB61   <------------AtMYB77       ----------->RAV1(2)  ==================================HOX2a_HOX2a
----ALFIN1     <---------ALFIN1             <---------At4g35610--------->MYB59   --------->DEAR3(1)-
>TOE2(3)  --------->ANAC58          <---------DOF5.7(1)---------->ID1   ==========================HOX2a_HOX2a
>AtMYB61  --------->ANAC58      <---------ALFIN1    ======================HOX2a_HOX2a<---------DEAR3(2)
 
cctctcctttcacaagctcaaccgccacgtcatcaccactcttcttcacctgttcctcgtcgtaattaggatctccttcatccatcgccggtggatccgg  3091400
                                    <-------MYC2
                                    ------->MYC3
                                    ------->MYC2
                                    ------->PIF5
                                    <-------MYC3        ----------->HVH21
                                    ------->MYC4       <---------MYB59
                                    <-------MYC4 --------->TGA1a
                                   ========================bZIP_bZIP
                                   <---------TGA1a    <---------O2
                                   --------->TGA1a<-----------HVH21
                                   <---------O2  <---------O2
    <---------ANAC55(2)            --------->O2  <---------TGA1a
    --------->ANAC55(2)            <---------ANAC46----------->HVH21
------->TEIL                      <---------TOE1(2)<---------MYB52(1)   <---------DEAR3(1)
---->At4g35610       <------ZmHOX2a(2)         ------>NtERF2           --------->ATERF1(1)
--->LBD16            ===============HOX2a_HOX2a--------->LBD16        <-----------HVH21
---RAP2.6(2)------>ZmHOX2a(1)------>ZmHOX2a(1)--------->ANAC46       <---------MYB46(3)
===================HOX2a_HOX2a   <------------OsbHLH66<---------bZIP60(2)         ==================
--LBD16  <---------YAB5 xxxxxxxxxxxxxxxx>smallRNA(s)  --------->At4g35610 <------NtERF2
===================HOX2a_HOX2a   <---------ALFIN1--------->O2       <---------AtMYB61            ===
-----At4g35610      --------->GATA12<-------PIF5<------NtERF2     <---------MYB46(3)--------->GLK1(1)
-----NtERF2 ================HOX2a_HOX2a      <---------LBD16     <---------AtMYB61<------ZmHOX2a(1)
-------->REM1(1)    <-----------HVH21   ------->TEIL  <---------At4g35610 ----------->RAV1(2)    <--
 
ctgcatctcgtaatcctccatccgatcaggtccttcccacgtgtacttcccgccgtgacctgacttcgatggtggtcgcctgagaggaatcccatcggaa  3091500
             <---------MYB52(1)
     <------ZmHOX2a(2)                                              <---------ANAC58
    --------->ARR11(2)                                              <---------bZIP60(2)
    --------->RVE1(2)                         ------->GAMYB         <---------ANAC55(2)
    --------->GATA12 <---------DOF5.7(1)  ---------->CDC5           <---------ANAC46
    <---------GATA12 <---------DAG2       <---------WRKY38(1)       --------->ANAC55(2)          ---
    --------->ARR14(2)                    <---------WRKY12          <---------ANAC58             <--
    <---------ARR14(2)                  --------->ANAC46            <---------ANAC55(1)         <---
    <---------ARR11(2)<----------DOF2  --------->At4g35610    --------->LBD16                   ----
--------->YAB5--------->WRKY12         <---------At4g35610  <---------LBD16                     <---
============HOX2a_HOX2a          --------->HSFC1(2)       <---------ARR11(2)                    ----
============HOX2a_HOX2a          <---------HSFC1(2)       --------->ARR11(2)                    <---
----ZmHOX2a(1)--------->WRKY38(1)--------->At4g35610   ------>ZmHOX2a(2)             <---------KAN1
 
ggatgacgatccatccgttgaacacctttctccataagcttccgctcaacgctcttgatcgtctccggattacgtgtcttcacttcgaacttatcaacag  3091600
                                                                                             -------
                                                                                            --------
           --------->KAN1                                                                   <-------
          <---------YAB5                                                                    --------
     <---------DOF5.7(1)                                                                    <-------
   ------>NtERF2                    --------->DEAR3(1)                                      <-------
  ------>NtERF2                     --------->AtMYB61                                      ---------
  --------->LBD16                   <---------ALFIN1                                       <--------
 <---------RAP2.6(2)               <---------ABI4(2)                                       ---------
<---------LBD16                    --------->MYB46(3)                                      ---------
------>GLK1(1)               --------->LBD16                                               <--------
-------GLK1(1)           ------>NtERF2                                           --------->CCA1(2)
------GLK1(2)           --------->DEAR3(1)                               ------->TEIL ----------->GT1
----->GATA12            <---------ALFIN1                            ----------->RAV1(2)    ---------
------GATA12 <---------YAB1 --------->ANAC46                       ------>NtERF2<---------ARR11(3)
----->ARR14(2)         --------->ATERF1(1)                --------->At4g35610   --------->ARR11(3)
------ARR14(2)        <---------ATERF1(1)                 <---------At4g35610   <---------RVE1(2)---
 
atttccggccttcttcattcttgtgctccgcccgtagcaccaccgtgtttttggtttcatcaactgataccgcctgcatcttagatatacagaaataaat  3091700
  ----------->GT1
-->WOX13(1)
->AHL12(1)
--AHL12(1)                           --------->YAB1
->AHL20(2)                         --------->WOX13(2)
--AHL25(3)                       <---------AHL20(2)
--AHL20(2)                       --------->AHL20(2)                                      --------->ALFIN1
>AHL25(3)                        --------->AHL25(1)                                    <---------ANAC46
-AHL25(1)                    <---------ANAC58                                          <---------ANAC58
>AHL20(2)             ------->TEIL <---------WOX13(2)                   --------->ALFIN1<-----------HVH21
>AHL12(3)             <---------TOE1(2)                                 <---------KAN1 <---------ANAC58
-AHL12(3)  --------->ZAT14   <---------ANAC58    --------->DOF5.7(1)  *TSS<---------ANAC46       <--
>AHL25(1)  <---------ZAT14   <---------ANAC46  ---------->DOF2--------->AHL20(2)      <-------TEIL
------->DOF2      <---------------AtSPL3  <---------KAN1    <----------DOF2          --------->ALFIN1
 
caaagtcgtgatacttcactacttgtacgtttgcgtttaattagaatgagcaaagagtgttttctttatataagagtgtgtgtaagaggtgcgtgagggg  3091800
                                                                          <---------HSFC1(2)
                                                                          --------->HSFC1(2)
                                                                          --------->HSFB2a(1)
                                                                        --------->ARR11(2)
                                                                     --------->HSFB2a(2)
                                                                     --------->ANAC58
                                                                     --------->ANAC58
                                                                     --------->ANAC55(2)
                                                                     <---------ANAC55(2)
                   --------->ARR11(3)                                <---------HSFB2a(2)
                   --------->RVE1(2)                                <---------LBD16
                   <---------ARR11(3)                             <---------SPL7(1)
                  --------->RVE1(1)                             --------->At4g35610     <---------AHL20(2)
                  --------->CCA1(1)                             <---------At4g35610    --------->AHL25(3)
                 <---------AHL25(2)                            <---------TOE1(2)    <---------AHL20(3)
                 --------->AHL25(2)                           <---------CCA1(2)     --------->AHL20(3)
         <----------ID1                                    <---------HSFB2a(2)      <---------AHL20(2)
       <---------------AtSPL8                              --------->HSFB2a(2)      --------->AHL25(1)
     --------->CCA1(2)                                 <----------DOF2  <---------ARR11(2)
    --------->ARR14(2)                                <---------DOF5.7(1) <---------HSFB2a(1)      <
    <---------ARR11(2)      <------------CBF         ---------->ID1--------->MYB52(1)  <---------AHL20(2)
    <---------ARR14(2) --------->At4g35610       <---------ANAC58<---------ANAC58   --------->AHL20(2)
-------KAN1     --------->AHL20(3)               <---------ANAC58<---------ANAC58  <---------DOF5.7(1)
 
ataagaagataggggacaaaaatatctgatgaattgaagtttctagcgactaccttgtctttctcgtagcttacggaaacttctcatttttttatttgag  3091900
          <-----------GT1                                      <------MYB46(1)
          --------->RVE1(2)      --------->WOX13(2)            <------MYB83
        <---------YAB5           <---------WOX13(2)           --------->MYB59
        --------->ICU4         <---------YAB1       <---------YAB1                              ----
       --------->WOX13(2)    --------------->AGL15 --------->AHL20(3)                          <----
       <---------AHL12(2)    <---------------AGL15 --------->AHL20(2)                          <----
     --------->AHL20(2)     <-----------------AGL3 <---------AHL20(2)                          -----
   --------->ANAC55(2)      --------->ZAT6         --------->AHL12(3)                        <------
   --------->ANAC58         <-----------------AGL2 <---------AHL12(3)                        -------
   <---------ANAC55(2)      <-----------------AGL1 <---------AHL20(3)                     --------->ANAC46
   ----------->GT1        --------->KAN1 <----------DOF2  <---------ZAT6            <---------MYB46(3)
   --------->ANAC58     <-------GAMYB   <---------DOF5.7(1) <---------MYB52(1)--------->ANAC55(2)
-----------HVH21       --------->ALFIN1 <----------DOF2<-----------GT1        <---------ANAC55(2)  -
 
tctgtcaagtaattatccattcgagggtgttactctaattgggcctttgtgtatttttatactgttcggtccccatacattacatgtttgttcacatcat  3092000
     --------->AHL20(3)
     <---------AHL20(3)
     <---------AHL25(2)
     --------->AHL25(2)
    <---------AHL12(1)                                                             --------->WOX13(1)
    --------->AHL25(1)                                                            -------->ATHB1
    --------->AHL12(1)                                                            --------->YAB1
----->ATHB12                                                                      --------->YAB5
-----YAB5                <---------GLK1(2)             <---------ICU4             <---------ICU4
-----YAB1                <---------RVE1(2)         ---------->DOF2               <---------YAB5
---->ICU4                <---------GATA12        <---------YAB1        --------->TOE2(3)   ---------
---ICU4    <---------RVE1(2)              --------->YAB1              ----------->GT1    ---------->DOF2
-->YAB1  <---------YAB1  <---------ARR11(3)    <---------ZAT6         --------->YAB1  --------->YAB1
----->ZmHOX2a(2)         --------->ARR11(3)  --------->YAB1     --------->YAB1   <---------ATHB12
 
gatcggattattttgatactcagcaatagattttgacatttgctctaatagtattaaagcattacaaacaaaatcgtaaatacaatcattcagaaagaag  3092100
                                    ------->MYC3
                                    <-------MYC3
                                   <---------TGA1a
                  ===========================bZIP_DOF
     <---------DOF5.7(2)           --------->O2                                                   <-
     --------->MYB52(1)   --------->RVE1(1)                                                    <----
    <---------WRKY38(1)  --------->ARR11(3)                                                    <----
    <---------WRKY45     --------->GLK1(2)                                                 <--------
    <---------WRKY12     --------->RVE1(2)  --------->ARR11(3)                            <---------DAG2
   --------->WRKY18(1)   <---------ARR11(3) <---------ARR11(3)                            <---------DOF5.7(1)
 --------->WOX13(1) ----------->GT1--------->TGA1a     <-----------GT1    <---------AtLEC2<---------
>DOF5.7(1)        ---------->DOF2  <---------O2     <---------ICU4      <---------YAB1   <---------DOF5.7(1)
 
aagtcagtcaacgaagatggagaaagaaaatctctcaaacgtgtcaacatcttcaatattacaacgtcttcacttgtgaatggagcaactctcctttttc  3092200
                             --------->LBD16
                             ----------->GT1
                            --------->ANAC58
                            --------->ANAC58
                            --------->ANAC55(2)
                            <---------ANAC55(2)
                            --------->HSFB2a(2)
                            <---------HSFB2a(2)
                           <---------LBD16
                          --------->MYB52(1)
                        <---------ANAC58
                        <---------ANAC58
                      <---------AHL20(2)
                    --------->WOX13(2)
                   --------->YAB5
                   <---------ICU4
                  <---------AHL20(2)
                  <---------AHL12(3)
                  --------->AHL12(3)
                  --------->AHL25(1)
                  <---------AHL25(1)
                  --------->AHL20(2)
                  <---------AHL12(1)
                  --------->AHL12(1)
                  <---------YAB1
                  --------->AHL25(3)
                  <---------AHL25(3)
                 <---------AHL25(3)
                 --------->AHL25(3)
                 --------->AHL20(2)
                 <---------AHL20(1)
                 --------->AHL20(1)
                 --------->AHL20(3)
                 <---------AHL20(3)
                 <---------AHL25(2)                                                            <----
  <---------At4g35610 --------->AHL20(2)                                                  <---------DOF5.7(1)
----------HVH21  --------->AHL25(2)                                                      <---------DOF5.7(1)
-----ANAC58      --------->AHL25(1)                                                  --------->ANAC46
-----ANAC58      <---------AHL25(1)              ---------->DOF2                     --------->ANAC58
-DOF5.7(1)      --------->YAB1           <-------MYC3     <---------YAB1         <---------MYB52(2)
-DOF2           --------->AHL12(2)       ------->MYC3<---------ZAT6   --------->KAN1 --------->ANAC58
 
ttgtcaactcatctatgaaatataattacttacggaaaaaacaacgtgtttacaaagtgttatgaattcacacatatactactaactcacgccccttccg  3092300
<- Previous    Next ->

AGI:  At3g10020.1   
Description:  similar to Os12g0147200 [Oryza sativa (japonica cultivar-group)] (GB:NP_001066153.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15981.1); similar to Os11g0149200 [Oryza sativa (japonica cultivar-group)] (GB:NP_001065754.1)
Range:  from: 3091048    to: 3091771    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g10030.1   
Description:  aspartate/glutamate/uridylate kinase family protein. similar to aspartate/glutamate/uridylate kinase family protein [Arabidopsis thaliana] (TAIR:AT3G18680.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15999.1); contains InterPro domain Aspartate/glutamate/uridylate kinase; (InterPro:IPR001048); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005)
Range:  from: 3092028    to: 3094950    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version