AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                      <XXXXXXXXXXXXXXXXXXXXMIR844
                                                                  ----------->GT1
                                                               --------->DOF5.7(1)
                                                              --------->DAG2
                                                              --------->DOF5.7(1)
                                                          --------->AHL20(2)
                                                       <---------WOX13(2)
                                                       --------->WOX13(2)
                                                     --------->AHL25(1)
                                                     --------->AHL20(3)
                                                     --------->AHL25(3)       --------->ARR11(3)
        <---------At4g35610                          <---------AHL25(3)       <---------GATA12
     --------->At4g35610                             <---------AHL12(3)       <---------ARR11(3)
     <---------ZAT2  --------->DOF5.7(1)             <---------AHL25(1)     --------->AHL12(1)
     <---------At4g35610                             --------->AHL20(2)   --------->AHL12(2)
<---------ZAT14     --------->AHL20(2)               --------->AHL12(3)  --------->YAB1
------->ZAT14       --------->AHL25(2)               <---------AHL20(2) <---------YAB1
------------AtSPL8  <---------AHL25(2)   <---------ARR11(3)  ---------->DOF2<---------AHL12(1)
---->DOF5.7(1)      <---------AHL25(1)   --------->ARR11(3)  --------->DOF5.7(1)--------->TOE2(3)
--->DOF2--------->At4g35610             <---------GLK1(1) <---------AHL25(3)<---------AHL20(2)
-->DOF5.7(1)        <---------AHL12(3) <---------RVE1(2) --------->AHL20(2) <---------AHL25(3) <----
 
gagtactcggctgctacaaaaaaaaaaatgaagtagttgtttgatatctcttgaatttaaataaaaaaggagtttataataaatcttagcaaagttttct  2519000
                                                                                           <--------
                                                                                           <--------
                                                                                          --------->AHL25(2)
                                                                                          --------->AHL20(1)
                                                                                          --------->AHL25(3)
                                                                                          <---------AHL25(3)
                                                                                          <---------AHL12(1)
                                                                                          --------->AHL12(1)
                                                                                          <---------AHL25(2)
                                                                                          <---------AHL25(1)
             <---------YAB1                                                               --------->AHL20(2)
            <---------AHL20(3)                                                            <---------AHL20(2)
            --------->AHL25(2)                                                            <---------AHL12(3)
            <---------AHL20(1)                                                            --------->AHL25(1)
            <---------AHL25(2)                                                           <---------AHL12(3)
            --------->AHL20(2)                                                           --------->AHL20(2)
            --------->AHL20(3)                                                           --------->AHL12(3)
            <---------AHL20(2)                                                           --------->AHL25(1)
           --------->YAB1                                                                --------->AHL25(2)
          <---------YAB1 --------->ANAC55(2)                                             --------->AHL25(3)
         --------->AHL20(2)               <-----------GT1                                <---------AHL25(2)
         --------->AHL20(3)          --------->TOE2(3)                      --------->ANAC58       <
         <---------AHL20(3)          --------->TOE1(3)                      --------->ANAC58      <-
         <---------AHL25(2)   <---------HSFB2a(2)                           --------->ANAC46   <----
  <----------DOF2    <-----------HVH21--------->DOF5.7(2)    <---------YAB5<---------REM1(2)  <-----
-----YAB1--------->AHL25(2)--------->ARR14(2)       <---------ALFIN1    ------>ZmHOX2a(1)<---------AHL25(1)
 
gatacctttcaatattataattgtggtcacgttctgcaaacgttatcacctttgaacacctctaatcttcttctcctctacgcagtcaaaaaaaaaatta  2519100
                         --------->LBD16
                        <---------HSFB2a(2)
                        <---------HSFC1(1)
                        --------->HSFB2a(2)
                        --------->HSFC1(1)
                  <---------CCA1(1)
                  <---------RVE1(1)
   ----------->GT1--------->KAN1
-ICU4        --------->DOF5.7(1)                                       <-----------GT1
-AHL12(2)  --------->DOF5.7(1)                                    --------->ATHB12
---------GLK1(2) <---------ARR11(3)                              <---------YAB1
--------At4g35610--------->ARR11(3)                              <---------YAB5                  <--
-----At5g28300   <---------RVE1(2)                        <----------DOF2      <---------ANAC46 ----
------GT1  ---------->DOF2       ---------->DOF2    --------->ATHB12<---------GLK1(1)      ---------
 
cagcttctgttaaaaaaagagatatttccagaaactaaaagaagctaagaacagatgatttcttttttatgatttctctatctcgtgaacaaatggcact  2519200
                                                                     <---------ICU4
                                                                     --------->YAB1
                                                                    <---------YAB1
                                                                    <---------YAB5
                                                                    --------->ICU4
                                                                   <---------AHL20(3)
                                                                   --------->AHL12(2)
                                                                   <---------AHL12(2)
                                                                   --------->AHL25(2)
                                                                   --------->AHL20(3)
                                                                   <---------AHL12(3)
                                                                  <---------AHL25(3)
                                                                  <---------ICU4
                                                                  --------->YAB5
                                                                  --------->YAB1
                                                                 --------->AHL25(2)
                                                                 <---------AHL25(1)
                                                                 --------->AHL25(1)
                                                                 <---------AHL25(3)
                                                                 <---------AHL12(1)
                                                                 --------->AHL12(1)
                               <---------AHL25(3)                <---------AHL12(3)
                              --------->AHL20(2)                 --------->AHL25(3)
                              <---------AHL20(2)                 --------->AHL12(3)
                              --------->AHL20(3)                 --------->ICU4
                              <---------AHL12(3)                 <---------ATHB51
                              --------->AHL12(3)                 <---------AHL20(2)              ---
                              <---------AHL20(3)                --------->AHL12(2)              ----
                              --------->AHL25(1)                --------->AHL25(3)         <--------
                              --------->AHL12(1)                <---------AHL12(2)         ---------
                              <---------AHL12(1)                --------->AHL20(3)        --------->AHL25(1)
                              --------->AHL25(3)                <---------AHL25(2)        --------->AHL25(2)
                              <---------AHL25(1)          ----------->GT1                 <---------AHL25(2)
                            <---------WOX13(2)           --------->DOF5.7(1)              <---------AHL12(1)
        ----------->GT1 <----------DOF2                  --------->DAG2                   --------->AHL12(1)
       --------->DOF5.7(1)  --------->WOX13(2)          --------->DOF5.7(1)               <---------AHL25(1)
      --------->DOF5.7(1) --------->AHL20(2) ---------->DOF2    --------->AHL25(2)        --------->AHL20(2)
     ---------->DOF2    --------->TOE2(3)   <------ZmHOX2a(1)   <---------AHL20(3)  ----------->GT1
-------TOE2(3) --------->AHL20(2)  ----------->GT1      ---------->DOF2<---------YAB1     --------->AHL20(3)
------>DOF2  <---------WOX13(2)<---------AHL20(2) ---------->DOF2--------->AHL20(2) --------->AtLEC2
>ZAT18--------->DAG2    --------->TOE1(3) <---------TOE2(3)----------->GT1   ---------->DOF2    <---
 
aaagttggaaaaggagaattaaaacaactttaaataaatagaaataaggaaagaaaagaaaaaggaaaataattataactgaaagaaatgcaaaaaattc  2519300
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                               <----
                                                                                             <------
                                                                                       <---------WOX13(1)
                        <---------KAN1                                                <---------RVE1(2)
                        <---------CCA1(2)                                             >>>>>>>>>ARR2
                      --------->ANAC46                                                <------------CBF
                     --------->LBD16              --------->YAB1                     --------->ATHB12
                <---------GLK1(1)                 <---------ICU4                 --------->GLK1(2)
 <------ZmHOX2a(1)   ------>NtERF2               <---------ATHB51               <---------RVE1(2)
------>LBD16   --------->GATA12                  --------->ICU4                 *TSS<---------YAB1
----->HSFB2a(2)<---------GATA12      <XXXXXXXXXXXXXXXXXXXXMIR413                <---------ARR11(3)
-AHL12(1)     <---------GLK1(2)  <---------MYB46(3) <---------YAB1              --------->ARR11(3)
>KAN1<-------GAMYB <---------LBD16 <---------HSFB2a(2)                 <------ZmHOX2a(1)<---------MYB46(3)
------HSFB2a(2)------->TEIL    <-------GAMYB----------->GT1     <---------KAN1  <---------GLK1(2)
 
cagaggagcgttgaattgaatctccgcgtctctcggttgtcgaagaagagaaattatgagagttggaatttggaggagatagagattttgattgttgagg  2519400
                                                                                  <---------TOE2(3)
                                                                                  <---------WOX13(2)
                                                                                  --------->WOX13(2)
                                                                               <---------AHL20(3)
                                                                               <---------YAB1
                                                                               <---------AHL20(2)
                                        <------------CBF             --------->AHL12(2)
                                      <------MYB46(1)            <-------GAMYB--------->YAB1
                                      <------MYB83        <---------YAB1      --------->TOE2(3)
                             --------->At4g35610         <---------AHL20(3) --------->AHL25(2)
                             <---------ZAT2              <---------AHL12(3) <---------AHL20(3)
         --------->KAN1      <---------At4g35610         <---------AHL20(2) <---------AHL20(2)
     ----------->GT1         --------->ZAT2             <---------ICU4      --------->AHL20(3)
------ARR14(2)              <---------AGP1            --------->AHL12(2)    <---------AHL25(2) <----
------ARR11(2)          <---------RVE1(2)           --------->AHL20(2)     --------->YAB1    <------
----->ARR14(2)     --------->TOE2(3)<--------P      <---------AHL20(2)    <---------YAB1   ---------
--ZmHOX2a(1)       <----------DOF2 <-------GAMYB    --------->AHL25(3) <---------AHL20(2)<---------GLK1(2)
---TOE2(3)   --------->TOE1(3) --------->ALFIN1  <----------DOF2----------->GT1<---------AHL12(3)
 
aaatgggagagtttatccctaactttagatagagctggggttggattgagagcttttaatttttatggggttattttataatattaatgaaagattgtga  2519500
                                                            <---------TOE1(2)
                                                  --------->ICU4
                                                  <---------YAB1            --------->YAB5
                                                --------->ATHB12            <---------ICU4
                                                --------->YAB5              --------->ATHB12
                                     --------->ANAC58      <-----------RAV1(2)
                                     <---------ANAC55(2) <---------ANAC46   --------->YAB1
                                     --------->ANAC58 ----------->HVH21     -------->ATHB1
    ----------->GT1        <---------RVE1(2)    --------->KAN1             <---------ATHB12   <-----
-----RVE1(2)          <---------ANAC46         <---------YAB5        <----------DOF2     <------NtERF2
---YAB1       <-----------GT1     <---------RVE1(2)   ----------->TGA1     <---------YAB5--------->At4g35610
-->GT1   <---------YAB1    <---------YAB5--------->DOF5.7(1)<---------TOE2(2)    <---------YAB1   <-
 
ttttgaaacgttactatttacaactacgtagagattggataagtaagagagtcattagtgacgcaggtttaactttgaatcattgttatggcagcaagat  2519600
                         --------->YAB5
                      <---------WOX13(2)
                  --------->TOE1(3)                       <---------WOX13(1)
         ------>ZmHOX2a(1)     --------->YAB1            <---------RVE1(2)
     <-----------GT1  --------->WOX13(2)                --------->ATHB12
  <---------KAN1  --------->TOE2(3)                    --------->ICU4
 ------->TEIL    ----------->GT1                       <---------YAB1         <------ZmHOX2a(1)
----GLK1(2)  <---------DAG2<---------YAB1              <---------YAB5        <----------ID1
--------YAB1 <----------DOF2  <---------YAB1<----------DOF2       <-----------HVH21   ----------->GT1
 
tatgaatttctccttacttttcgttaaatgactattatagccctgaactttgtttgtattgattggctctgtcatttctaaggacaaatgtgtaatttca  2519700
                                                                                           ---------
                                                                                         <----------
                                                                                       <---------YAB1
                                                                                      <---------AHL12(2)
                                                                                     --------->AHL12(1)
                                                                                     <---------AHL20(2)
                                                                                     --------->YAB1
                                                                                     -------->ATHB1
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL12(1)
                                                                                     <--------HAHB4
                                                                                     --------->ATHB51
                                                                                     <---------ICU4
                                                                                    <---------ATHB51
                                                                                    <---------YAB1
                                                                                    <---------YAB5
                                                                                    --------->ICU4
                                                                                    --------->AHL25(3)
                                                                                   <---------AHL25(2)
                                                                                   --------->AHL12(2)
                                                                                   <---------AHL12(2)
                                                                                   <---------AHL12(3)
                                                                                   --------->AHL12(3)
                                                                                   --------->AHL25(2)
                                                                                  --------->YAB1
                                                                                  <---------ICU4
                                                                                  --------->YAB5
                                                                                  <---------AHL25(3)
                                                                                 <---------ATHB51
                                                                                 --------->AHL12(1)
                                                                                 --------->AHL25(3)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL25(1)
                                                                                 <---------AHL12(3)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL12(3)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL25(3)
                                                                                 --------->ICU4
                                                                                 <---------AHL12(1)
                                                                                 --------->AHL20(2)
                                                                                <---------AHL20(1)
                                                                                --------->AHL25(3)
                                            <---------AHL20(2)                  <---------AHL20(3)
                                           <---------AHL25(1)                   <---------AHL25(2)
                                           --------->AHL25(3)                   --------->AHL12(3) -
               --------->ANAC58            --------->AHL20(2)                   --------->AHL25(2) <
               --------->ANAC58            <---------AHL12(3)                   --------->AHL12(2) -
              --------->DAG2               <---------AHL20(2)                   --------->AHL20(3) -
             ---------->DOF2               --------->AHL12(3)                  --------->AHL12(2)  -
          <---------WOX13(2)       --------->RVE1(2)   --------->CCA1(2)  ----------->GT1<<<<<<<<<<<
          --------->WOX13(2)   <-------TEIL--------->AHL25(1)        --------->CCA1(2)--------->AHL12(2)
      ----------->GT1  <---------ANAC58 --------->GATA12          --------->DOF5.7(1)-------->HAHB4-
     ----------->GT1   <---------ANAC58 <---------GATA12        ---------->DOF2--------->YAB1    ---
 
taaacgatgtgttaaataaagcaatttcttgatgttcatatcagatttaaattgcaagatagagagagaaagagacgatgtaaaataattattaacactg  2519800
           <---------AHL20(2)
     <---------AHL12(2)
    --------->AHL12(3)
    <---------AHL20(2)
    --------->AHL20(3)
    <---------AHL25(2)
    --------->AHL20(2)
    <---------AHL20(1)
    <---------AHL25(3)
    --------->AHL25(2)
    <---------AHL20(3)
    <---------AHL25(1)
    --------->AHL25(1)
   <---------AHL20(2)
   --------->AHL20(2)
   --------->AHL25(3)
 --------->WOX13(2)
 <---------WOX13(2)
>ZAT6--------->AHL12(2)                         --------->At4g35610
-GT1--------->AHL25(3)                         --------->ALFIN1
-------->AHL20(2)                             <-------MYC3
---------AHL12(1)                             ------->MYC2                                       ---
-------->AHL25(1)                             <-------MYC2                                     -----
-------->AHL25(3)                             ------->MYC3                                  --------
-------->AHL12(1)                        <---------AHL20(2)             --------->RVE1(2)   --------
<<<<<<LFY --------->AHL20(2)           <---------WOX13(2)          <---------KAN1 <---------RVE1(2)
-------->ICU4                      ----------->GT1     ----------->HVH21------->TEIL  <-------TEIL
------>GATA12      --------->KAN1  <---------DEAR3(2)<---------TGA1a   <---------CCA1(2)   <--------
 
gatttattaaattttaaatttcaaattccacaattcgtcggtaataaaacgtgctgaagtgacatatagcatatgtatctaatgtgatgttcatatgata  2519900
<- Previous    Next ->

AGI:  At3g07890.1   
Description:  RabGAP/TBC domain-containing protein. similar to RAB GTPase activator [Arabidopsis thaliana] (TAIR:AT2G39280.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23986.1); contains InterPro domain RabGAP/TBC; (InterPro:IPR000195)
Range:  from: 2516310    to: 2519381    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version