AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         <-----------GT1
      --------->WOX13(2)
    <---------YAB1                       --------->ANAC46
    --------->ICU4           <-------TEIL--------->ANAC58                              ------->GAMYB
  --------->YAB1 --------->ANAC46    --------->ANAC58                                 --------->MYB46(3)
  --------->TOE2(3) ----------->RAV1(1)  --------->ANAC58  --------->KAN1             <---------MYB52(2)
  --------->TOE1(3)--------->ANAC46  --------->ANAC58   <-------TEIL             <-----------GT1
 
tcaaaccataattcacttctccacaacacatatacatatgaagcaagcaagtagaaacatacatattcacttcaaacccagttttcacaacaaacccatg  1495000
                     --------->TOE2(3)
                 --------->RVE1(2)
                 --------->ARR11(3)                                             <---------DOF5.7(1)
                 <---------ARR11(3)                                             <----------DOF2
                 --------->ARR14(2)                                <---------LBD16
                 <---------ARR14(2)                            --------->AHL12(1)
                 <---------ARR11(2)                            --------->KAN1  <---------DOF5.7(1)
                <---------GLK1(1)                              <---------AHL12(1)  --------->HSFB2a(2)
                <---------KAN4(1)     --------->TOE2(3) ----------->GT1        <---------DAG2
                --------->KAN1     --------->ANAC58    --------->DOF5.7(1)  <-----------GT1
                <---------KAN1   <---------KAN1       ---------->DOF2      <---------KAN1
       --------->LBD16       --------->LBD16        <------ZmHOX2a(1)     <---------KAN4(2)   <-----
     <---------LBD16 --------->TOE1(3)--------->TOE1(3)--------->DAG2--------->LBD16          <-----
    ------->GAMYB--------->KAN4(2) --------->ANAC58<----------ID1--------->GLK1(2) <---------HSFB2a(2)
 
aacacaactcccgaattgaatatcccttaacccagaacaagccttaagaacataaggaaaagtgaaataatccggagaataaccttttcgaagcatttct  1495100
                      --------->ARR14(2)
                      --------->GATA12
                      --------->ARR11(2)
                      <---------ARR11(2)
                      <---------RVE1(2)
                      <---------ARR14(2)
             <---------DAG2
      <------ZmHOX2a(2)
     --------->RVE1(2)<---------GATA12
     <---------ARR11(3)
     --------->ARR11(3)
 ---------->DOF2  <---------LBD16                                            --------->KAN1
----ANAC58   <----------DOF2                     --------->YAB1  <---------AHL20(2)                <
----ANAC58   <---------------AGL15              <---------YAB1--------->RVE1(2)                    -
 
tggtaaaagatcaatgctttatctggatttggactgtttgagtagcctctgatcatagagttccatatataaacacttggacaatcgatactttcgaaaa  1495200
                                                                                                 <--
                                                                                                 ---
                                                                                         <---------GATA12
                                                                       <---------ANAC58  --------->GATA12
         --------->ZAT2                                                <---------bZIP60(2)      <---
         --------->At4g35610                                        ----------->TGA1     <---------ARR14(2)
         <---------At4g35610                                        ----------->HVH21    <---------ARR11(2)
         <---------ZAT2                                             <---------KAN1       --------->ARR14(2)
       <---------CCA1(2)                    --------->GLK1(1)    <------ZmHOX2a(1)    <---------TOE2(3)
     <---------ANAC58                  --------->ZAT18     <----------DOF2        <---------WOX13(2)
     <---------ANAC58                  <---------ZAT18   <------NtERF2 <---------ANAC58 <------ZmHOX2a(1)
 ===================================HOX2a_HOX2a          <---------At4g35610  --------->YAB1    ----
 ------>ZmHOX2a(2)--------->YAB1       <---------ZAT14   --------->At4g35610 <---------YAB1     <---
---------GATA12--------->GATA12        --------->ZAT14 <---------DEAR3(1) <---------ARR11(2)   <----
-------->ARR11(3)<-------TEIL<------ZmHOX2a(1)         <---------RAP2.6(2)--------->ARR11(2)   <----
 
ctgatctcgcgtagctgagattcatagtctcaggacaagtagtgcagaaatctatgagtcggcttagaggaatgacgtttctgataactgaggatttgat  1495300
                                 ------>ZmHOX2a(2)
                                --------->At4g35610
                               <---------GATA12
                               --------->ARR11(3)
                               <---------ARR11(3)
                               <---------RVE1(2)
                              --------->YAB1
-------WOX13(2)              <---------ATHB12                                              <--------
------>TOE2(3)            --------->AtMYB61                                               --------->YAB5
-----HAHB4               --------->MYB46(3)                                            <----------DOF2
----->YAB5          --------->ARR14(2)        --------->ZAT2                       <---------GLK1(2)
------ICU4          --------->ARR11(2)        --------->At4g35610                 --------->KAN1----
-----YAB1           <---------ARR14(2)        <---------ZAT2  <---------ANAC46  --------->YAB1 <----
-----YAB5           <---------ARR11(2)        <---------At4g35610              <---------YAB5-------
 
cattaaaccatggagttgattcagttccaccaatgatctgcaattctctagctgagagagaattggtttgtagtgcttcttcatcatattctttgattat  1495400
                                    --------->YAB1
                                    --------->YAB5
                                    --------->TOE1(3)                       ----------->GT1
                                    --------->TOE2(3)                  <---------WOX13(2)
                                 --------->ARR11(2)                 <--------P
                                 <---------ARR11(2)               ----------->GT1   --------->AHL20(2)
                        <---------AHL25(1)                      <---------ANAC58  <---------AHL20(2)
                   --------->AHL12(2)    --------->MYB46(3)     <---------ANAC46  --------->AHL20(2)
      ---------->DOF2   <---------AHL20(2)                      <---------ANAC58 <---------WOX13(2)
-RVE1(2)      --------->ICU4  <---------HSFB2a(2)               <---------bZIP60(2)<---------AHL20(2)
----->YAB1------------>CBF    --------->HSFB2a(2)             --------->MYB52(1)--------->WOX13(2)
-----YAB1--------->ANAC58     <---------HSFC1(1)             ----------->HVH21  <---------WOX13(2)
-->YAB1  --------->ANAC58    <---------LBD16             ---------->DOF2   --------->MYB59
 
catgaaattcaaaggcaatgtttttttttaattctggaaccataacaaacaaaaactcatcaaagtgacgggtaaattttggtaatttaaaatagtttgg  1495500
                                                                                       ---------->DOF2
                                                                                      <---------MYB52(1)
                                 <---------YAB1                                       <---------ARR11(2)
                             <---------AHL25(2)                                       --------->ARR11(2)
                             --------->AHL25(2)                                       ----------->HVH21
                             <---------AHL20(3)                                      <---------SPL7(1)
                             --------->AHL20(3)              ----------->RAV1(2)    --------->RAP2.6(2)
                            --------->AHL25(1)             <-----------GT1         <------NtERF2
                            <---------AHL12(1)          <---------AHL12(2)         --------->RAP2.3(1)
                            --------->AHL12(1)        <---------AHL20(3)          ------>NtERF2
                         <------ZmHOX2a(1)            --------->AHL20(3)         --------->ANAC46
                         --------->YAB5               <---------AHL12(3)         <---------DEAR3(1)
         --------->YAB5<---------TOE1(3)            >>>>>>>>>>GT-3b              --------->DEAR3(1)-
    <---------YAB1     <---------TOE2(3)       ---------->DOF2--------->TOE2(2)------->GAMYB    <---
 
gtttattttgaatgttgaaagagtttaaggattattttgaaagtttcaacaaaagaaaaatataacctgtgtttagtcacaacgacgccgtaacgctgaa  1495600
                                                         <---------ATERF1(1)
                                                         <---------DEAR4(2)
                                                         <---------RAP2.3(1)
                                                         ------>NtERF2
                                                         <---------ERF1
                                                        --------->DEAR3(1)
                                                        <---------RAP2.3(2)
                                                        --------->ATERF1(2)
                                                     ------>ZmHOX2a(2)
                                                    <------ZmHOX2a(2)
                                                   <---------ARR14(2)
                                                   --------->GATA12
                                                   --------->ARR14(2)
                                                   <---------GATA12
                                                   --------->ARR11(3)
                                                   <---------ARR11(3)
                                          --------->ATERF1(1)
                                          --------->RAP2.3(1)
                                          <------NtERF2 <---------ATERF1(2)
                                         <---------ATERF1(1)        --------->ARR11(2)
                                         <---------ORA47(2)         --------->ARR14(2)
                                         ------>NtERF2 --------->ATERF1(1)           ------>ZmHOX2a(2)
                                         <---------RAP2.3(1)    <---------At4g35610  ===============
                                         <---------ERF1<---------LBD16              <------ZmHOX2a(2)
                                        <---------ANAC46<---------DEAR3(1)         <---------ARR14(2)
                                        <---------RAP2.3(2)   <---------PCF2       --------->ARR11(2)
                                        <---------RRTF1(3)<------NtERF2 --------->WOX13(2)      ====
                                        --------->ATERF1(2)  <------NtERF2         <---------GATA12
                                        <---------ATERF1(2)  --------->ATERF1(1)   --------->GATA12
                                        <---------DEAR3(1)<---------LBD16          --------->ARR14(2)
                                        <---------RAP2.6(2) <---------MYB46(3)     <---------ARR11(2)
                                        <---------RAP2.3(3) ------>NtERF2          <---------RVE1(2)
     --------->MYB52(1)          <------MYB46(1)  --------->GLK1(1) <---------ARR11(2)          ====
  *TSS                           <------MYB83     <---------GLK1(1) <---------ARR14(2)  <---------RVE1(2)
 ------>NtERF2                <-------GAMYB     <------ZmHOX2a(1) <---------MYB46(3)================
-------->At4g35610    <-----------HVH21 <---------RRTF1(2)--------->ATERF1(1)      ------->TEIL ----
------YAB5       ----------->RAV1(2)    <---------DREB2C(2)<---------ANAC46 <---------TOE2(3) ------
 
tcagcgccaagcggagagagacctgagtcagtgagttggtatggcggcgaaggagatcgccggcgggagcggttctattgacgatggatccgattttgat  1495700
                                    -------->P
                                    ------>MYB83         --------->ANAC58
                                    ------>MYB46(1)      --------->ANAC58
                                   ------>ZmHOX2a(1)  <---------SPL7(1)
           --------------------->WRI1 --------->TOE2(3) --------->SPL7(1)
           <---------ANAC58    <---------ARR11(2)    <---------ANAC58
           <---------ANAC58    --------->ARR14(2)    <---------ANAC58
    ------>ZmHOX2a(1)          <---------ARR14(2)   <---------------AtSPL3
===========HOX2a_HOX2a         <---------GATA12     --------------->AtSPL3
===============================HOX2a_HOX2a          --------------->AtSPL8                         <
===========HOX2a_HOX2a      <---------MYB52(1)    <---------ARR11(2)<----------DOF2               --
===========HOX2a_HOX2a    <---------ANAC46        ------------------>SPL14                        --
-->ZmHOX2a(2)           ------>ZmHOX2a(1)         --------->ARR11(2)<---------DOF5.7(1)        <----
--->GATA12 <---------ANAC46--------->LBD16 <-----------GT1         <---------DOF5.7(1)        <-----
 
ccatgtcctatttgccttggacaattcctccgtgaatcctaccttgatacctgtttccgtacgcttcttctctttttcagttttctgttaaaacttgtgg  1495800
                                                                                             -------
                                                                                             <------
                                                                                            --------
                                                                                        --------->ATHB12
                                                                                        --------->YAB5
                                                                                      <---------WOX13(1)
                                                                                     --------->GATA12
                                                                                  --------->YAB1
                                                                                 <---------YAB5
                                                                              --------->AHL25(1)
                                                                              --------->AHL20(2)
                                                                              <---------AHL20(2)
                                                                              <---------AHL25(1)
                                                                              <---------AHL25(3)
                                                                             <---------AHL25(1)
                                   <---------ANAC46                          --------->AHL25(2)
  --------->HSFC1(2)               <---------ANAC58                          --------->AHL25(1)
  <---------HSFC1(2)               <---------ANAC58                          <---------AHL25(2)
---------At4g35610     <---------KAN1                                        --------->AHL20(3)
--------->ARR10      <---------GLK1(2)                    <----------DOF2    <---------AHL20(2)
------->MYB52(2)  --------->HSFB2a(2)                    <---------DOF5.7(1) --------->AHL20(2)
---GAMYB --------->ATHB12        <---------YAB1     <-------TEIL             --------->AHL25(3)  <--
----MYB46(3)      <---------HSFB2a(2)            --------->YAB5              <---------AHL20(3)<----
 
ttagatgcttcttgatttcatctagaatttgaagttttgagtgtgtattcaaagattcaatcttttttttctgtgaacaatttaatcagattgattagtt  1495900
<- Previous    Next ->

AGI:  At3g05240.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT1G08070.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17639.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 1493690    to: 1495387    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g05250.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. similar to zinc finger (C3HC4-type RING finger) family protein / BRCT domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G67180.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17638.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 1495603    to: 1497475    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version