AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                           --------->At4g35610
                         ------>ZmHOX2a(2)
                        <---------GLK1(1)
                       <---------RVE1(2)
                       --------->ARR11(3)
                       --------->GATA12
                       <---------ARR11(2)
                       <---------ARR11(3)                                                  ---------
                       --------->ARR14(2)                                              <------ZmHOX2a(1)
                       --------->ARR11(2)                                             <---------At4g35610
                       <---------GATA12                                               --------->At4g35610
                       <---------AGP1 ----------->RAV1(1)                            >>>>>>>GRF7
            --------->CCA1(2)        ----------->HVH21    --------->YAB1            <-----------RAV1(2)
           <---------RVE1(2) <----------DOF2           <----------DOF2            <-----------HVH21
          --------->YAB1<---------At4g35610          --------->HSFB2a(1)       <---------ANAC58
 --------->LBD16       ------->TEIL  <---------ETT(1)--------->HSFC1(2)        <---------ANAC58
--------->HSFB2a(2)    <---------ARR14(2)            <---------HSFC1(2)        <---------AtLEC2    -
 
cacccagaaacaatgatatggcaatggatctgcttcacttccgacagaaaactcgaagctttcatgagatagagaaacgtttgcctgtcaggagagacac  1303000
                                                           <---------YAB1
                                                         --------->GLK1(1)
                                                         <---------GLK1(1)
                                                        <---------ARR11(3)
                                                    <---------At4g35610
      --------->YAB1                             ---------->DOF2
     <---------ATHB12                        --------->ANAC58                                -------
     <---------YAB5                  <-----------GT1--------->At4g35610                   <------MYB46(1)
     <---------YAB1                <---------DOF5.7(1)  --------->ARR14(2)                <------MYB83
 <---------MYB59               <-------TEIL  --------->ANAC58       ----------->GT1     <--------P <
>CCA1(2)                ---------->DOF2   --------->ZAT2--------->ARR11(3)              --------->ALFIN1
----->NtERF2           --------->AtMYB61  <---------ZAT2<---------ARR14(2)      --------->KAN1     -
 
ggtgcctaatcatagaactatacagaccaaagcattcatttttcgagctcgaaacagcagatatcattgtgttgtaaacaaaaacattcgggttgggagt  1303100
                                                                                   --------->ARR11(2)
                                                                                   <---------ARR11(2)
                              --------->GLK1(2)                                 <---------ANAC55(2)
                             --------->ARR14(2)                   <---------RAP2.3(2)
                             <---------GLK1(2)                    <---------DEAR3(1)
             --------->HSFC1(2)                                --------->DOF5.7(1) ------->TEIL
             --------->HSFB2a(1)                             --------->CCA1(2)  --------->ANAC55(2)
             <---------HSFC1(2)                    --------->HSFB2a(2)       --------->ARR11(2)
   <---------TOE2(3)         <---------ARR14(2)    <---------HSFB2a(2)       <---------ARR11(2)
---->GT1     <---------HSFB2a(1)  <---------LBD16  ------>NtERF2  <---------RAP2.3(3)    <---------At4g35610
---------WOX13(2)           --------->KAN1        --------->DEAR3(1)<---------At4g35610  --------->At4g35610
-------->WOX13(2)          ----------->ARR10   ------>ZmHOX2a(2) --------->RAP2.6(3)   <-----------RAV1(2)
 
gaaattaagaaatagaagcttcgccaagtcgagattctctgggtatgtgatcgccgagaagaagataagacggctcatgggaaacgtatcgcagatgaga  1303200
                                                                                 <---------At4g35610
                                                                                 --------->ZAT2
                                                                                 ----------->RAV1(2)
                                       <---------HSFB2a(2)                       <---------ZAT2
                                       --------->HSFB2a(2)                 --------->YAB5
          ====================================HOX2a_HOX2a             <---------WOX13(1)
          ------>ZmHOX2a(2)            ------>ZmHOX2a(1)    --------->ANAC58     --------->At4g35610
        --------->ARR11(3)             --------->LBD16      --------->ANAC58   <-----------RAV1(2)
        <---------ARR11(3)            <---------LBD16   --------->ANAC58  <---------YAB1
      <---------KAN1             --------->YAB5         --------->ANAC58  <---------YAB5           <
  --------->ANAC58        <----------DOF2            <---------HSFB2a(2) <---------TOE2(3) <--------
  --------->ANAC58       <---------ANAC46            --------->HSFB2a(2)--------->YAB1   --------->ATHB12
 
ttgaaacgcatgatctgtgccaaaacctgcttgaattgattcctggaattgcaattctcgagcaagacaagagattgatgattcagctgaagtgattgaa  1303300
                                                        --------->LBD16
               <---------ANAC58                         ------>NtERF2
               <---------ANAC58                         <------NtERF2
          <-------GAMYB                                --------->RAP2.6(2)
          <---------ANAC58                             --------->ANAC46
          <---------ANAC58                             --------->DEAR3(1)
         <------MYB46(1)                               --------->RAP2.3(2)
  ------>ZmHOX2a(2)                                    --------->RRTF1(2)
 <------ZmHOX2a(2)                                  <---------DEAR3(1)
--------->RVE1(2)                                   --------->ANAC46
<---------ARR11(2)                     --------->KAN1 --------->RAP2.3(1)
<---------ARR14(2)            <---------ANAC58     ------>ZmHOX2a(1)
<---------ARR11(3)            <---------ANAC58 <---------ARR14(2)
--------->ARR11(2)         --------->GLK1(2)   --------->ARR14(2)    ---------->DOF2              --
--------->ARR14(2)        <---------GLK1(2)   <---------GLK1(1) ----------->RAV1(1)            -----
<---------GATA12         --------->KAN1--------->AHL12(1)      --------->MYB46(3)         --------->YAB1
--------->GATA12       ----------->RAV1(1) --------->YAB1   --------->MYB46(3)           <---------YAB1
------ZmHOX2a(1)    --------->PCF2     <---------AHL20(2)   --------->REM1(1)      <---------------AGL15
-WOX13(1)<------MYB83  <---------ALFIN1<---------AHL12(1) ----------->RAV1(1)     <-----------------AGL3
 
caggatcccatttggttgtcttgctcccacattctgtgccaaataatcgaaatcctcgccgcaacaacaacacaaagcacatacttctatttttgataac  1303400
                                         <---------WOX13(2)
                                         <---------AHL12(2)
                                         --------->WOX13(2)
                                        --------->AHL12(3)
                                        <---------AHL20(2)
                                        <---------AHL12(3)
                                        --------->AHL25(1)
                                        --------->AHL20(3)
                                        <---------AHL25(3)
                                        --------->AHL25(2)
                                        <---------AHL20(3)
                                        --------->AHL20(2)
                                       <---------AHL25(3)
                                       <---------AHL12(1)
                                       <---------AHL20(2)
                                       --------->AHL20(2)
                                       <---------AHL12(3)
                                       <---------AHL20(1)
                                       --------->AHL20(1)
                                       <---------AHL25(1)
                                       --------->AHL25(3)
                                       --------->AHL12(1)
                                       --------->AHL25(1)
                                       --------->AHL12(3)
                                       <---------AHL25(2)
                                       --------->AHL25(2)
                                      --------->AHL12(3)
                                <---------AHL20(2)
                                --------->AHL20(2)
                    <---------ICU4    <---------AHL12(3)
                    --------->YAB1    --------->AHL25(1)
                   <---------YAB5     <---------AHL25(2)
                   --------->ICU4     --------->AHL20(2)
                  --------->WOX13(2)  --------->AHL25(2)
                  <---------WOX13(2)  <---------AHL25(1)
                <---------AHL20(2)    --------->AHL25(3)                    ---------->DOF2
              ----------->GT1 --------->WOX13(2)  <------NtERF2 ----------->RAV1(2)
              <---------ANAC55(2)    --------->AHL12(2)         <---------At4g35610    <---------AHL20(3)
-------->DOF2 --------->ANAC55(2)<---------AHL20(2)             --------->At4g35610    --------->AHL20(3)
---->ZAT6    --------->MYB59  <---------WOX13(2) --------->RAP2.6(2)    <---------WOX13(2)
 
acaaagcacatcaagttatgtaattatgttcttaatttaaaattaatttaggccgcatcgatatatcatctggcccattaaaagcccgattaatatggac  1303500
                <------------CBF
              --------->ARR14(2)                                              ------------>CBF
              <---------ARR14(2)                                              ----------------->AGL1
              --------->ARR11(3)                                         <---------GATA12  ---------
              <---------ARR11(3)                                <---------GATA12     <------MYB46(1)
              <---------RVE1(2)                                 --------->GATA12     <------MYB83
              <---------ARR14(3)                          <---------------AtSPL8    --------->MYB59
              --------->ARR14(3)                   <---------RVE1(2)     --------->GATA12  <--------
      ------->TEIL                       <---------DOF5.7(1)  <-------TEIL--------->At4g35610   ----
    --------->ZAT14                      <----------DOF2  --------------->AtSPL8 <---------WOX13(2)<
    <---------ZAT14                     <---------DOF5.7(1)   ------->TEIL<---------At4g35610 ------
 
tattctctgtacttgaagatattgtttttagtataagaagaacccttttctatggattttgtatgtacatctaatacatctgccaatttggttcgatttg  1303600
      --------->TOE2(3)
     <---------YAB1
    <---------ARR11(3)
    --------->ARR11(3)
   --------->YAB1
  <---------YAB5                      ----------->GT1         <---------ANAC58    <-----------TBP
 --------->WOX13(2)                  <---------YAB5           <---------ANAC58----------->GT1
 <---------WOX13(2)                 ------->TEIL              <---------ANAC46<------MYB46(1)
>GATA12                          --------->ANAC58         --------->At4g35610 <------MYB83
-RVE1(2)                         --------->ANAC46         <---------At4g35610 <---------ANAC46
------>ID1                 <----------DOF2             --------->DOF5.7(1)   --------->MYB46(2)
---------YAB1           <-----------GT1        ------------>CBF              --------->MYB59
--->KAN1   <---------RVE1(2)     --------->ANAC58    ---------->DOF2     <---------YAB1        -----
 
ttctaattatcttagataataggtgtttaactttacacgaatcgtagaaacacaatgaaagagctgcttgcacattatgtttggtatataaaactagagg  1303700
                                                                           =========================
                                                                           <---------TGA1a
                                                                           --------->TGA1a
                                                                           <---------ZAT2
                                                                           --------->ZAT2
                                                                  <-----------RAV1(1)
                                                           <---------AHL20(1)
                                                           --------->AHL20(1)
                                     --------->At4g35610   --------->RVE1(2)
            <---------PCF5        <---------At4g35610      <---------ARR11(3)
           ----------->HVH21     ------------>AtMYB77      --------->ARR11(3)
         <---------LBD16   --------->At4g35610             <---------ARR14(3)
         <---------ANAC58  <---------ZAT2                  --------->ARR14(3)
         <---------HSFB2a(2)    <--------P                 <-----------ARR10      --------->GLK1(1)
         <---------ANAC58  <---------At4g35610             --------->ARR14(2)  <---------AtMYB61
         --------->HSFB2a(2)<-----------RAV1(2)            <---------ARR14(2)--------->ALFIN1  >>>>>
        <---------LBD16    --------->ZAT2  --------->At4g35610    <---------REM1(1)    ------>ZmHOX2a(1)
      <---------SPL7(1) --------->At4g35610<---------At4g35610    ===================RAV       <<<<<
------>GT1--------->LBD16 ----------->RAV1(1)       ----------->GT1      <-----------RAV1(2) <------
 
gcaaaacgtcttccgggaccaagtatgagcagcaggtagcagttgcagctatggactgtcaatatcttggtgttgcacaggtgaggtttccttacacttt  1303800
                                                          <------ZmHOX2a(2)
                                                         --------->ARR11(2)
                                                         <---------ARR11(2)
                                                     <---------LBD16
                                                    ----------->RAV1(2)                   <---------
                             <---------AHL20(2)    --------->GLK1(2)           <----------DOF2   <--
====bZIP_DOF           ------>ZmHOX2a(2)    <---------ANAC58              --------->HSFB2a(2)  -----
>>>>>>>>>>>>LFY  --------->ANAC55(2)        <---------ANAC58          <---------GLK1(2) --------->WOX13(2)
<<<<<<<<<<<<LFY  <---------ANAC55(2)     <----------DOF2 --------->GATA12 <---------HSFB2a(2)  -----
----DOF2         <---------ANAC46       <---------DOF5.7(1)   <---------MYB52(1)    --------->ANAC55(2)
 
ccattggtaccttgagaactacgtgatcgtattttaagaacaccctttcttgaaaacctggatcagttatctaggttctcgactttcacttaataaccaa  1303900
<- Previous    Next ->

AGI:  At3g04750.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT2G29760.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43072.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 1301397    to: 1303382    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g04760.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT1G09900.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65084.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN67401.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 1303581    to: 1305884    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version