AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                 ---
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                         <---------ANAC58
 --------->MYB52(1)                                                                      <---------ANAC58
---NtERF2                                                                               <-------TEIL
->NtERF2                                  --------->YAB1                              <---------ARR14(2)
---->LBD16                        --------->GATA12                                    --------->ARR14(2)
--->LBD16                         <---------ARR14(2)                           <---------ZAT2 <-----
--->ANAC46                        --------->ARR11(2)                           <---------At4g35610
---LBD16                          <---------ARR11(2)                       <-----------HVH21  <-----
--ATERF1(1)          --------->YAB1 ------>ZmHOX2a(2)                 ------->TEIL    --------->ARR11(2)
-HVH21         <---------ARR11(3) <---------GATA12              --------->ETT(2)      <---------ARR11(2)
 
gcattaacagaagcacaagagctatcaacacaatggggatcgaaatcacaagtagaagaccacgatgtcgatggaccttgtcagcaagggattcgtgccg  1070900
  ===============================HOX2a_HOX2a                                                  <-----
  ------>ZmHOX2a(2)                                                                           <-----
 ================================HOX2a_HOX2a                                                ------>NtERF2
 <------ZmHOX2a(2)                                                                          --------
--------->GATA12               <---------ETT(2)                                           <---------MYB52(1)
------>SPL7(1)            ------>ZmHOX2a(1)                                          --------->GLK1(2)
-------HVH21          <-----------GT1                                              <---------KAN1
-----RAP2.6(3)      <---------DOF5.7(1)                                            --------->KAN1
->NtERF2        <------NtERF2  --------->ETT(2)                                    <----------TaMYB80
-----SPL7(1)    <---------MYB52(1)                                              --------->LBD16
----ANAC46     ------>NtERF2 --------->LBD16                                  <---------LBD16<------NtERF2
--->ATERF1(2)  <-----------HVH21                   <---------YAB1            --------->MYB52(1)
--->DEAR3(1)   <---------RAP2.6(3)        --------->ANAC58               <---------MYB46(3) <-------
----ANAC58    --------->ANAC46<---------------------WRI1                 --------->YAB5  --------->LBD16
----ANAC58    --------->DEAR3(1)          --------->ANAC58              <---------YAB5 <---------LBD16
----ATERF1(2) --------->RAP2.3(3)     --------->ANAC46             <------ZmHOX2a(1)--------->KAN1
 
tccgatcgctcgcttcgccgtcatttttcctccgtcgatagacacaagtccctgatgagagtcggaagtaggagaatggttaccggataatccggtggct  1071000
                                                         <---------ANAC58
                                                         <---------ANAC46
                                                        <---------LBD16
                                                        <------NtERF2                             <-
                                                        --------->ATERF1(1)                     ----
                                           ==========================HOX2a_HOX2a               <----
                                           ------>ZmHOX2a(2)           <---------ARR11(3)      =====
                                          ===========================HOX2a_HOX2a               =====
                                          <------ZmHOX2a(2)       <---------------------WRI1   -----
                                         --------->ARR11(3)     <---------DEAR3(1)             =====
                                         <---------GLK1(2)     --------->SPL7(1)               =====
                                         --------->GATA12<---------ANAC58                      =====
                                         <---------RVE1(2)--------->LBD16                    <------
                                         <---------GATA12<---------DEAR3(1)                  -------
                                         --------->ARR11(2)   <------ZmHOX2a(1)              ------>ZmHOX2a(2)
                                    <---------DOF5.7(2)------>NtERF2  --------->GLK1(1)     <------ZmHOX2a(2)
                                    --------->MYB52(1) <---------MYB46(3)       <------ZmHOX2a(1) --
                                   <---------ARR11(2) --------->ALFIN1<---------GLK1(1)    <--------
                                   --------->ARR11(2) <---------DEAR3(1)        ===================HOX2a_HOX2a
                                  --------->DOF5.7(2) ----------->HVH21--------->ARR14(2)  <--------
                                  --------->At5g28300<---------MYB52(1)--------->ARR11(3)  <--------
                              --------->MYB52(1)     <-----------HVH21<---------CCA1(2)    ---------
                              <---------DOF5.7(2)   --------->LBD16  <---------MYB52(1)    ---------
                             <---------WRKY38(1)   --------->LBD16<------NtERF2 ====================HOX2a_HOX2a
                           <---------------AtSPL3 <---------LBD16------>NtERF2  ====================
----ANAC58                <------MYB83   --------->ARR14(2)   <---------ATERF1(1)          ---------
----ANAC58                <------MYB46(1)<---------ARR11(2)--------->ATERF1(1)  ====================
->MYB55(2)          --------->At4g35610  <---------ARR14(2)<------NtERF2        ====================
--MYB46(3) --------->RVE1(2) <---------WRKY12------>ZmHOX2a(1)=====================================HOX2a_HOX2a
 
agtccagactccaatagctcagaagcggaaggtgaacggtaacggatcctgttcccggtggcggaggacgccgatatcttcaaggactgcgagggatcct  1071100
           ------>ZmHOX2a(2)
           <---------DEAR3(1)
     ------>ZmHOX2a(2)
    <------ZmHOX2a(2)
   --------->GATA12
   <---------GATA12
   <---------ARR11(2)
   --------->ARR11(2)
   --------->ARR14(2)
   <---------ARR14(2)
--------DOF5.7(2)
----->DOF5.7(2)
------DOF2<------ZmHOX2a(2)
============HOX2a_HOX2a                                                              --------->CCA1(2)
===========HOX2a_HOX2a                                                              <---------ARR11(2)
->ZmHOX2a(1)                             <---------LBD16                            --------->AGP1
==================HOX2a_HOX2a           --------->MYB52(1)                          --------->ARR14(2)
========================HOX2a_HOX2a     -------->P                                  <---------AGP1
=================HOX2a_HOX2a          <----------DOF2                               --------->ARR11(2)
-----------AGL3    --------->ATHB12  <---------ANAC58                               <---------ARR14(2)
---------->AGL3  <------ZmHOX2a(2)   <---------ANAC58                               <---------ARR11(3)
------->MYB52(1)--------->GATA12    --------->At4g35610                             <---------GATA12
-ARR14(2)<---------GATA12           <---------At4g35610                             --------->ARR11(3)
-ARR11(2)--------->GATA12        <---------At4g35610                                --------->RVE1(2)
-ARR11(3)--------->ARR14(2)    <---------ANAC46                                     <---------RVE1(2)
>ARR11(2)<---------ARR14(2)    <---------RAP2.6(2)                                  --------->GATA12
>ARR11(3)--------->ARR11(2)   <---------At5g28300    ------>ZmHOX2a(1)       <---------ALFIN1
===========HOX2a_HOX2a    --------->ANAC58    <---------WOX13(1)           ----------->RAV1(1)
>ARR14(2)<---------ARR11(2)   --------->RAP2.6(3)  ------>ZmHOX2a(2) --------->GLK1(2)------>ZmHOX2a(2)
=================HOX2a_HOX2a --------->MYB52(1)  <---------RVE1(2)  <---------GLK1(2)<------ZmHOX2a(2)
============HOX2a_HOX2a   --------->ANAC58 --------->LBD16         --------->KAN1  <---------CCA1(2)
 
ttaacggatccagatcggcgatcgattgcaagttacggctgcttaccggattgatcctatgcttcgattcaaattctgccacacacagatctgaatcgtg  1071200
                                                 --------->YAB5
                                                 <---------ICU4
                                               <---------TOE2(3)
                                               <---------TOE1(3)
                   --------->AtMYB61        <---------AHL20(2)
              --------->SPL7(1)            <---------AHL12(2)
             --------->CCA1(2)            --------->WOX13(2)                        <---------At4g35610
            --------->ARR11(2)            <---------WOX13(2)                        --------->At4g35610
            <---------ARR11(2)           <---------ICU4            ----------->GT1 --------->DOF5.7(1)
         <---------------------WRI1     <---------YAB1--------->ANAC55(2)         --------->DOF5.7(1)
        <---------DOF5.7(2)           --------->YAB1  --------->ANAC58            --------->DAG2
      --------->DOF5.7(2)          <---------bZIP60(1)--------->ANAC58        --------->ANAC46
      ----------->HVH21            <---------TGA2(1) <---------LBD16          --------->ANAC58
    <---------ANAC58               --------->bZIP60(1)--------->ANAC46        --------->ANAC58
    <---------ANAC46            <---------MYB52(1) --------->ARR11(2)        --------->LBD16
    <---------ANAC58       --------->DOF5.7(1)<-----------GT1  --------->CCA1(2) ---------->DOF2
    <---------AtLEC2     ---------->DOF2--------->ICU4<---------ANAC55(2)--------->GATA12      <----
 
aagttttgcgtgaacgatacgaccaaaacaaagacgttatgtcataatttaacgattacggaagagaaatgggtaacatccacgaaaagctgattttagt  1071300
                                         ------------>CBF
                                      --------->DOF5.7(1)           <---------ANAC58
                                     --------->MYB52(1)             <---------ANAC58
                                  <---------AHL12(2)           <---------AHL25(3)
                                  --------->WOX13(2)          --------->AHL25(1)
                                 <---------AHL12(2)           --------->AHL20(3)
                                --------->AHL25(3)            --------->AHL12(3)
                                <---------AHL25(2)            <---------AHL12(1)
                                --------->AHL12(1)            <---------AHL25(1)
                                --------->AHL20(1)            <---------AHL25(3)
                                <---------AHL12(1)            --------->AHL25(3)
                                --------->AHL20(2)            --------->AHL12(1)
                                --------->AHL25(1)            <---------AHL12(3)
                                <---------AHL25(3)            --------->AHL20(2)                   -
                                --------->AHL25(2)            <---------AHL20(3)                   -
                                <---------AHL20(1)            <---------AHL20(2)                   -
                                <---------AHL25(1)          --------->WOX13(2)                    --
                                <---------AHL20(3)          <---------WOX13(2)                    --
                                --------->AHL20(3)          <---------AHL12(2)               -------
                                <---------AHL20(2)          --------->AHL12(2)               <------
                               --------->AHL25(3)       --------->YAB1             ------>MYB46(1)--
                               --------->AHL20(2)       --------->TOE2(3)          --------->ANAC46<
                               <---------ATHB12        <---------ZAT6              --------->ANAC58<
                           ------------>CBF            ----------->GT1             --------->ANAC58-
 *TSS                      --------->AHL20(2)     <---------At4g35610              ------>MYB83  ---
-----ZAT6          <-----------GT1<---------WOX13(2)  <---------TOE2(3)    ----------->TBP   <------
 
gtaaagtttagacaaaactttttaacaaaattcaataaattaagggcaatttgagctaatgttaattaaatacttgctataaaaccaagccaaacaaatc  1071400
                  --------->LBD16
       --------->MYB59
    --------->WOX13(2)
    <---------WOX13(2)
<---------------AGL15
--------------->AGL15
---------------->AGL1
---------------->AGL3
---------------->AGL2
------>P        <---------LBD16
---->MYB83  <---------KAN1   ------>MYB46(1)
-->ARR14(2) --------->HSFB2a(1)
---ARR14(2) <---------HSFB2a(1)
---->MYB46(1)--------->KAN4(2)
-----------------AGL2        ------>MYB83
-----------------AGL3 --------->DOF5.7(1)               --------->ANAC46                          --
---------------->AG ---------->DOF2              --------->GLK1(2)                      <---------YAB1
--->ZmHOX2a(1) --------->MYB52(1)             <---------RVE1(2)                   --------->DOF5.7(1)
---GATA12<------ZmHOX2a(1) <---------MYB59   --------->YAB1               --------->MYB52(1)  <-----
 
ctaccaaaattaggaacataccggaaagaaccaaactaaaccagacattgataatctagacgttactaaaccgaaactagcagagaagagtgtgatagag  1071500
                     <---------DOF5.7(1)
             <---------AHL20(2)
            <---------AHL12(2)
         <---------YAB1
         --------->AHL12(2)
         <---------AHL12(2)
        --------->AHL12(2)                                                                         <
        --------->AHL25(2)                                                                         -
        --------->AHL20(3)                                                                         <
        <---------AHL20(1)                                                              <---------At4g35610
        <---------AHL20(3)                     <---------ARR11(2)                       --------->At4g35610
        <---------AHL25(2)          --------->WOX13(2)                                  --------->ZAT2
      --------->ICU4<----------DOF2 <---------WOX13(2)                     ----------->RAV1(1)     -
 ------->GAMYB--------->KAN1     ------>ZmHOX2a(1)            --------->TOE2(3)         <---------ZAT2
--------->MYB46(3)  <---------DOF5.7(1)        --------->ARR11(2) <---------WOX13(2)   <---------TOE1(2)
------->MYB52(1)<-----------GT1  --------------->AGL15        --------->YAB1  ------->GAMYB       --
----TOE2(3) --------->AHL12(2)   <---------------AGL15  --------->TOE2(3)  --------->MYB52(1)     <-
 
gtaacagacattattttttattccttttttgttctccttatttgagaatggaaccattttcttaatcttagttggaaacaacagacttcgcagcttgaag  1071600
                                                                                  <---------DOF5.7(1)
                                                                             <---------KAN1
                                                                             <------ZmHOX2a(2)
                                        <---------ALFIN1                   <------ZmHOX2a(1)
                                       --------->MYB46(3)                --------->MYB59
          --------->At4g35610        --------->AtMYB61                  --------->YAB1
      --------->RVE1(2)              <---------ALFIN1                 <---------WOX13(2)
  --------->ZAT6                    --------->MYB46(3)                --------->WOX13(2)           -
---------ARR14(2)                 --------->ANAC46                  <---------AHL20(2)            <-
-------->ARR14(2)                 --------->ANAC58                  --------->AHL20(2)            <-
---------ARR11(2)            XXXXXXXXXXXXXXXXXXXXX>MIR2935          --------->AHL25(1)           ---
-------->ARR11(2)         --------->LBD16                           <---------AHL25(1)    ----------
------->GLK1(1)          --------->LBD16--------->AtMYB61     <---------ATHB12 <-----------------AGL1
--------KAN1        --------->KAN1--------->ANAC58          --------->WOX13(1)--------->YAB5--------
 
catttccactatcagttgtcttcacatccctgaaaacacaccaccaccattttaagagttactcaatcagtttaattaggatcactcttatggcaaaggg  1071700
                                                          <---------ARR11(3)
                                                          --------->GATA12
                       <---------ARR14(2)      <---------At4g35610
                       --------->ARR14(2)      <---------ZAT14
                   ----------------->AGL1      <---------ZAT2
-------->YAB5      <-----------------AGL1      --------->At4g35610
--------YAB5    --------->ETT(2)               --------->ZAT2
--------KAN1    <---------ETT(2)               --------->ZAT14           ----------->GT1
------>GLK1(2)--------->ZAT14                --------->ANAC46     <---------At5g28300
>DOF2     <-----------GT1--------->TOE1(2) <---------ALFIN1      <-----------GT1            <-------
->DOF5.7(1) --------->ZAT6               ----------->RAV1(1)------>ZmHOX2a(2)         <---------MYB52(1)
 
aatcagtagtttttaactgtagaccgaaactgggaacaaaattgcaacacagcagagtcttgatctatttacagtttggagaaaatgttgttaggcttta  1071800
<- Previous    Next ->

AGI:  At3g04080.1   
Description:  ATAPY1 (APYRASE 1); calmodulin binding. similar to ATAPY2 (APYRASE 2) [Arabidopsis thaliana] (TAIR:AT5G18280.1); similar to apyrase [Vigna unguiculata subsp. unguiculata] (GB:BAD80837.1); contains InterPro domain Nucleoside phosphatase GDA1/CD39; (InterPro:IPR000407)
Range:  from: 1067797    to: 1071302    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version