AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
              --------->YAB1
            <-----------GT1                        <---------AHL12(3)
        <---------ARR11(3)                         --------->AHL12(3)
        --------->ARR11(3)                         <---------AHL20(2)
        <---------GATA12                          --------->AHL25(2)
  <---------YAB5                                  <---------AHL20(1)
--------->WOX13(1)                    <---------ICU4                                               -
---------AHL12(1)              <-----------ARR10  <---------AHL25(2)                               <
---------AHL25(3)              --------->RVE1(2)  --------->AHL25(3)                               <
---------AHL25(1)              <---------ARR11(3) <---------ARR11(3)                               -
-------->AHL25(1)         --------->MYB46(3)      --------->ARR11(3)                --------->HSFB2a(2)
-------->AHL12(1)       --------->ARR11(2)        --------->AHL20(1)          <---------AHL12(2) ---
-------->AHL20(2)       <---------ARR11(2)      --------->ARR11(3)     --------->ICU4          <----
---------AHL20(2)    <---------HSFB2a(2)        <---------RVE1(2)<-----------GT1    <---------HSFB2a(2)
------->AHL20(3)     --------->HSFB2a(2)  --------->YAB5      ----------->GT1 --------->AHL12(2) <--
------->AHL25(3)    ------>ZmHOX2a(2) --------->YAB1      --------->ZAT6<---------ICU4         -----
------->AHL20(2)    <---------LBD16  <---------ATHB12  <---------AHL20(2)   <---------AHL20(1) -----
------>WOX13(2)  --------->ATHB12    <---------YAB5--------->AHL25(1) --------->WOX13(2)       <----
-------WOX13(2) <---------YAB1 --------->ARR11(3)--------->CCA1(2)    <---------WOX13(2)   ---------
 
aattaatcaaagatttaacatgatcgggaaccaatatctaatcatcgattagatatatttaagtctagtaactaattagtatattttctacaaattgttt  618000
                                                                     --------->ARR11(3)
                                                               --------->ARR11(3)
                                                               --------->AHL20(1)
                                                               <---------AHL20(1)
                                                             --------->AHL12(2)                 <---
                                                             <---------AHL12(2)                <----
                                                            <---------AHL25(3)                 -----
                                                            <---------AHL20(2)                 -----
                                                            --------->AHL20(3)                 <----
                                                            <---------AHL20(3)                 -----
                                                            --------->YAB1                     <----
                                    --------->ANAC58        --------->AHL20(2)                 -----
           --------->ZAT14          --------->ANAC55(2)   <---------AHL12(2)                   -----
  <---------YAB5                    --------->ANAC58     --------->YAB1                        <----
-------->AHL20(2)                   <---------ANAC55(2)<---------AHL20(3)                      <----
---------AHL20(2)                 --------->ANAC58     --------->AHL20(3)                     ------
---------AHL25(1)            --------->ARR11(2)        <---------AHL12(3)                     <-----
-------->AHL25(1)       --------->DOF5.7(1)            <---------AHL20(2)                    -------
------>WOX13(2)        --------->DOF5.7(1)             --------->AHL12(3)                    <------
-----AHL25(1)          --------->DAG2                  --------->AHL20(2)                 <---------YAB5
-------WOX13(2)       ---------->DOF2                 <---------AHL12(2)        --------->ARR11(3)
---->AHL20(2)      <------MYB83 --------->KAN1        --------->AHL12(2)        <---------ARR11(3)
---->AHL25(1)      <------MYB46(1)--------->ANAC58  <---------ARR11(3)          <---------RVE1(2)
-----AHL20(2)     <---------MYB46(3)--------->ANAC46--------->AHL20(1)        ----------->ARR10<----
-->GT1     <---------ZAT14   <---------ARR11(2)   ------->TEIL <---------AHL20(2) ------>ZmHOX2a(2)<
 
aattaaacatatagtatacagttggtaaaggggaaacacgcgtaatctatatgtatatattaataatatatagttcttggtatgatcttcttagttattt  618100
                                                     ------->GAMYB
                                                    --------->MYB46(3)
                                                   <---------At5g28300
                                                  <-----------GT1
                                                  --------->MYB52(1)
                                               --------->WOX13(2)
                                               <---------WOX13(2)
                                               --------->AHL12(2)
                                             --------->AHL25(3)
                                             --------->AHL25(2)
                                             --------->AHL20(2)
                                             <---------AHL25(3)
                                             --------->AHL12(3)
                                             <---------AHL12(3)
                                             --------->AHL25(1)
                                             <---------AHL25(1)
                                             <---------AHL20(2)
                                             --------->AHL12(1)
                                             <---------AHL12(1)
                                            <---------AHL25(1)
                                            --------->AHL25(2)
                                            <---------AHL25(2)
                                            <---------AHL12(3)
                                            --------->AHL12(3)
                                            --------->AHL20(1)
                                            <---------AHL20(1)
                                            --------->AHL20(2)
                                            <---------AHL20(2)
                                            --------->AHL25(1)
                                            --------->AHL25(3)
                                            <---------AHL25(3)
                                           --------->AHL12(2)
                                           <---------AHL12(2)
                                          <---------AHL12(2)
                                         <---------AHL25(3)
                                         --------->AHL25(2)
                                         <---------AHL12(1)
                                         --------->AHL12(3)
                                         <---------AHL12(3)
                                         --------->AHL12(1)
                                        --------->AHL25(2)
                                        <---------AHL25(1)
                                        --------->AHL25(1)
       <----------DOF2                  --------->AHL20(2)
------AHL12(2)                          <---------AHL20(2)
-----AHL12(1)                           <---------AHL25(2)
---->AHL12(1)                           <---------AHL12(3)
---->AHL25(1)                           --------->AHL12(3)
-----AHL20(2)                           --------->AHL12(1)
---->AHL12(3)                           <---------AHL12(1)
-----AHL12(3)                           --------->AHL25(3)
---->AHL20(3)                           <---------AHL25(3)
---->AHL20(2)                          --------->AHL12(3)
-----AHL25(3)                          --------->AHL25(2)
-----AHL25(1)                          <---------AHL25(2)
--->AHL25(3)                           <---------AHL12(3)                <---------GATA12
----AHL20(2)                           --------->AHL25(1)       --------->DOF5.7(1)
-->AHL12(2)<---------HSFB2a(2)         <---------AHL25(1)       --------->DAG2
---AHL12(2)--------->HSFB2a(2)<---------AtLEC2 <---------AHL12(2)        --------->GATA12
-----AHL20(3)      <-----------GT1     --------->AHL20(2)      ---------->DOF2
-----------GT1  <----------DOF2        --------->AHL25(3)      --------->DOF5.7(1)
 
atttactaagctttctagactttaacaatatttgaatgaaaaaaaaatttaattaaccgtcgaaaaaaaagtcataaatctggacgcagaatactaatcc  618200
              <---------ICU4        --------->TOE1(3)
              --------->KAN1<---------ZAT18                            <----------DOF2
             <---------YAB5 --------->ZAT14                    <---------DOF5.7(1)                --
           <---------WRKY38(1)      --------->TOE2(3)         <----------DOF2               <-------
           <---------WRKY12 <---------ZAT14   <---------HSFB2a(1)  ---------->ID1          ---------
          --------->WRKY18(1)       <---------MYB59           <---------DOF5.7(1)          ---------
        ------->GAMYB     <---------At4g35610 --------->HSFB2a(1) <-----------GT1          ---------
 --------->GLK1(1)        --------->At4g35610 --------->KAN1 <---------DAG2                ---------
<---------GATA12  ----------------->AGL1--------->RVE1(2) <---------CCA1(2)             --------->TOE2(3)
 
acagatttcaacggtcaacattccaattcagttcacaaacctaaatcaaacgttccatttcataccttttttctctttcaagcttatacaacctttgacc  618300
                                                                              <---------AHL20(2)
                                                            --------->ANAC58--------->AHL20(3)
                                                            --------->ANAC46<---------AHL12(3)
                                                      --------->AHL20(2)    <-----------TBP
                                                 <---------AHL20(3)         --------->AHL12(3)
                                                 --------->AHL12(3)       --------->AHL12(3)
                                                 <---------AHL12(3)       <---------AHL20(2)
                                                 <---------AHL25(1)       --------->AHL25(1)
                                                 ----------->TBP <---------ANAC55(2)
                                                 --------->AHL20(3)      --------->AHL25(3)
              <---------ICU4                     --------->AHL25(1)      <---------AHL25(2)
         <---------YAB1                          --------->AHL20(2)   <---------KAN1
     <---------DAG2                              <---------AHL20(2)<------ZmHOX2a(1)
     <----------DOF2                         --------->AHL20(2)  <---------TOE1(3)
------->RVE1(2)         --------->MYB46(3)   --------->AHL12(3)  <---------TOE2(3)   <---------GATA12
--WRKY18(1)   <---------------AtSPL8    <-------TEIL  <---------AHL25(3) --------->AHL25(2) --------
>WRKY45 --------->AHL12(2)             --------->AtLEC2     --------->ANAC55(1)      --------->RVE1(2)
>WRKY12 <---------WOX13(2)  <---------DAG2   ----------->TBP--------->ANAC58<---------AHL20(3)
-->HVH21--------->WOX13(2)  <---------DOF5.7(1)----------->TBP   --------->ANAC55(2)--------->KAN1
>WRKY38(1) --------->YAB1<---------ALFIN1  <-----------TBP  <---------ANAC55(2) <-----------GT1-----
 
atgtctcactttattaataagtacaaaaccaccttacattacatgcatatatataaataaaacacgttaaggaacatatatttatacaaatcccataaac  618400
                            --------->AHL12(1)
                            <---------AHL12(3)
                            <---------AHL25(3)
                            <---------AHL25(1)
                            <---------AHL12(1)
                           <---------AHL12(2)
                           <---------AHL12(1)
                           --------->AHL12(2)
                           --------->AHL12(1)
                           --------->AHL25(3)
                           --------->AHL20(1)
                           <---------AHL20(1)            ------>MYB83
                           <---------AHL25(2)            ------>MYB46(1)
                           --------->AHL25(2)           ----------->RAV1(1)
                           --------->ARR11(3)         --------->MYB46(3)
                           <---------ARR11(3)        ------------------------>ANAC81
                          <---------AHL12(3)        ------>MYB46(1)            --------->ARR11(3)
                          --------->AHL12(2)      <---------MYB59  --------->DOF5.7(1)             -
                          <---------AHL12(2)      --------->AtMYB61--------->DAG2                  -
                 <---------KAN1                 ------------------------>ANAC81<---------ARR11(3)  <
-->DOF2          --------->KAN1      <----------DOF2------>MYB83  ---------->DOF2        <----------
---->ANAC46    *TSS       --------->AHL12(3) <------ZmHOX2a(1)    --------->DOF5.7(1) <---------ZAT6
 
cccatttcattcttcatcgaatagtcgaaaaatatttgaactttcttaggaaaccaaaccaacaaaacaaaaaggaaaacgagataatggtgttaccttg  618500
                                          --------->LBD16
                                     <---------GLK1(1)
                                     --------->GLK1(1)
                                   --------->ATHB12
                        --------->ANAC58  ------>NtERF2
                        <---------ANAC55(2)
           --------->ALFIN1     --------->WOX13(2)                                              <---
          <------ZmHOX2a(1)  <---------ATHB12   --------->ARR11(3)                      ------>ZmHOX2a(2)
<------ZmHOX2a(2)       --------->ANAC55(1)     <---------ARR11(3)                      --------->ANAC58
==============HOX2a_HOX2a --------->TGA2(2)     --------->RVE1(2)                       --------->ANAC58
=================HOX2a_HOX2a <---------YAB5    --------->GLK1(1)      --------->GLK1(2)<------ZmHOX2a(2)
-------->GATA12         --------->ANAC55(2)    <---------GLK1(1)    --------->KAN1    <---------GATA12
-------->ARR11(3)  --------->DOF5.7(1)   <---------LBD16     <---------ARR11(2)       --------->GATA12
---------GATA12  ---------->DOF2<---------WOX13(2)    <-----------HVH21               --------->ARR11(2)
-GT1   <------ZmHOX2a(1)--------->ANAC58<---------LBD16 <---------ANAC46              --------->ARR14(2)
 
gagatcaagaggaggagtagcaaagagacgtaatcaattgatttccggcgatatctccgtcgtggaaaccaagattccagttcaactccgatcgccatca  618600
                                                                                   <---------ANAC46
                                                                                   --------->TGA1a
                                                                                   <---------ANAC58
                       <-------MYC2          <---------DEAR3(1)                    <---------TGA1a
                       ------->MYC2     ----------->HVH21                          <---------ANAC58
                       <-------PIF4    <-----------HVH21                           <------NtERF2
                       ------->PIF4   --------->bZIP60(2)                         ------>NtERF2
                       ------->PIF5   <---------O2                               <---------ANAC46
                       ------->MYC3  <------NtERF2                              <------NtERF2
                       <-------PIF5  --------->LBD16                            --------->ATERF1(1)
                      <---------ANAC58--------->O2                             <---------ATERF1(1)
                      <---------ANAC58<---------ANAC46                         <---------RAP2.3(1)
                  --------->DEAR3(1) ------>NtERF2                            --------->DEAR3(1)
                <---------At5g28300 --------->DEAR3(1)                        <---------RAP2.3(2)
               <---------WRKY38(1) <------NtERF2                              <---------DEAR3(1)
              ----------->HVH21   ------>NtERF2                              <---------ZAT2
        --------->ARR14(2)        <---------RAP2.3(1)                        <------NtERF2
        <---------GATA12         --------->bZIP60(1)                         --------->ZAT2
        --------->GATA12         --------->ANAC46                            <---------At4g35610
        <---------ARR11(2)    --------->WRKY12<---------ANAC46           --------->ANAC58   --------
        <---------ARR14(2)  <---------At4g35610                          --------->ANAC46   <-------
        --------->ARR11(2)  <-------GAMYB--------->KAN1       <---------RVE1(2)<---------DEAR4(2) --
    <---------At4g35610<-------MYC3--------->ATERF1(1)       <------NtERF2   --------->At4g35610 <--
------TOE2(3)<-----------HVH21----------->HVH21 --------->ALFIN1         --------->ANAC58<------ZmHOX2a(1)
 
aggatagagcggattcagtcaccgcgcgtgctgttgacgccgcgtgatgcggtggagataagtcggagattgcaaaacgcagcggcgcgtgaggagtatg  618700
                                             ----------->HVH21             --------->ANAC58
                                          --------->ALFIN1                 --------->ANAC58
 <---------KAN1                --------->TOE1(2)      <---------KAN1     --------->MYB52(1)
->KAN1    <---------RVE1(2) --------->ARR11(3)    --------->ANAC58<------MYB83
--KAN1  <---------RVE1(2)   <---------ARR11(3)    --------->ANAC58<------MYB46(1)
---->NtERF2           --------->RVE1(2)  <------ZmHOX2a(1)       --------->MYB59              ------
-------ANAC46    --------->At4g35610 --------->DOF5.7(1)     --------->ALFIN1             <---------
 
ccgagtgtttggagattgtgagcaaaatcaagaacttgggaagaggaggggacacgaacaagaagtgtttggtccaaaacggaagcgttttggctttgtc  618800
                        <---------ANAC46
                        <---------ANAC55(2)
                        --------->ANAC55(2)
                        <---------ANAC58
                        <---------ANAC58
                       ------>NtERF2
                      <---------ANAC46
                     --------->ATERF1(1)
                     <------NtERF2
                    <---------ERF1
                    <---------ORA47(2)
                    <---------DEAR3(2)
                    <---------RAP2.3(1)
                    ------>NtERF2
                    <---------RRTF1(1)
                    <---------ATERF1(1)
                    <---------RAP2.6(1)
                    <---------DEAR4(2)
                   <---------RRTF1(3)
                   <---------RRTF1(2)
                   <---------RAP2.3(3)
                   --------->ATERF1(2)
                   <---------RAP2.3(2)
                   <---------ATERF1(2)
                   --------->ALFIN1
                   --------->DEAR3(1)
                   <---------DEAR3(1)
                  <---------ABI4(1)
                  <------NtERF2
                  --------->ATERF1(1)
                  --------->RAP2.3(1)
                  ------>NtERF2
                 <---------ATERF1(1)
                 <---------RAP2.3(1)
                <---------DEAR3(1)
                <---------RAP2.6(2)
                <---------RAP2.3(2)
               <---------LBD16              <---------WOX13(2)
             <-------TEIL ----------->HVH21--------->ATHB12
            --------->CCA1(2)          <---------ANAC58
            --------->ARR14(1)         <---------ANAC58
           --------->ARR11(2)          <---------ANAC46
           --------->ARR11(1)       ------->MYC2              <---------MYB46(3) <---------ANAC58
           <---------GATA12         <-------MYC2      --------->ARR11(3)         <---------ANAC58
           --------->ARR14(2)       ------->MYC3      <---------GATA12       <-------GAMYB         -
           <---------ARR14(2)       <-------MYC3      <---------ARR11(3)     <---------ANAC58      -
           <---------GLK1(2)       --------->KAN1    --------->GLK1(1)       <---------ANAC58      <
---->ID1  --------->KAN1<------NtERF2 <-------TEIL   <---------GLK1(1)      <---------MYB46(3)------
-DOF2     <---------HSFB2a(1)<---------WOX13(1)    <------ZmHOX2a(1)  --------->YAB1         <------ZmHOX2a(2)
 
ttcttgttttgaaagattcgcggcggcgcgtgatggacacatgcgtttattggaggaaatcttgtttgttctatcatcttggttgcctctgaatcgatca  618900
<- Previous    Next ->

AGI:  At3g02840.1   
Description:  immediate-early fungal elicitor family protein. similar to U-box domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G37490.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42397.1); contains InterPro domain Armadillo-type fold; (InterPro:IPR016024); contains InterPro domain Armadillo-like helical; (InterPro:IPR011989)
Range:  from: 618416    to: 619693    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version