AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                 <-------TEIL
                                                              <---------ANAC58
                                                              <---------ANAC58
                                                              <---------ANAC46
                                                             --------->ATERF1(1)
                                                             <------NtERF2
                                                            <---------ORA47(2)
                                                            <---------ERF1
                                                            <---------DEAR4(2)
                                                            <---------RRTF1(1)
                                                            ------>NtERF2
                                                            <---------ATERF1(1)
                                                            <---------RAP2.3(1)
                                                           --------->DEAR3(1)
                                                           <---------DEAR3(1)
                                                           <---------RAP2.3(3)
                                                           <---------RAP2.3(2)
                                                          ------>NtERF2
                                                          <------NtERF2
                                                          <---------ABI4(1)
                                                         <---------RRTF1(1)
                                                        <---------RAP2.6(2)
                                                        <---------RAP2.3(2)
                                                        <---------RRTF1(2)
                                                       <---------LBD16
                                                     <---------GATA12
                                         <---------ANAC58<---------ATERF1(1)
                                         <---------ANAC46<---------RAP2.3(1)
                                         <---------O2--------->GATA12
                          <-------GAMYB  <---------TGA1a<---------DEAR3(1)
                          =========================MYC_MYB--------->ATERF1(1)                      -
           <---------GATA12              <---------ANAC58<---------DEAR4(2)                        -
           <---------ARR14(2)      <---------HSFB2a(2) <-------TEIL                            <----
           --------->GATA12<---------MYB52(1)       --------->GLK1(1)                          <----
           <---------RVE1(2)       --------->HSFB2a(2)--------->ALFIN1                        ------
           <---------ARR11(2)  ====================bZIP_DOF<---------ANAC46                  <------
           --------->ARR11(2)  <----------DOF2      --------->At4g35610                      <------
           --------->ARR14(2) <---------ANAC58      <---------GLK1(1)                       <-------
       <-----------------AGL1 <---------ANAC58      --------->KAN1      <---------ANAC58   <--------
  ------>ZmHOX2a(1)      <-----------RAV1(1)      <------ZmHOX2a(1)     <---------ANAC58<---------RAP2.3(3)
 
ctctcctaggcctggatttggcaaacctctgttgctttctagagtcgtgagtaggagatgcggcggcgttcatgggcttgagaatgctcttggggcggtc  19656800
                                              <---------PCF2
                                             --------->ATERF1(1)
                                             <---------ATERF1(1)
                                             <------NtERF2
                                            ------>NtERF2
                                            <---------MYB46(3)
                                           <---------ANAC46
                                          <---------LBD16
                                          <------NtERF2
-------->TOE2(3)                         <---------RAP2.3(1)
------>GAMYB                             <---------DEAR4(2)                    --------->ZAT18
-----WRKY12                             <---------DEAR3(1)                    <------NtERF2
-----WRKY38(1)                          <---------RAP2.3(2)                 --------->ALFIN1
--->WRKY18(1)         --------->ANAC58  <---------RAP2.6(2)            <---------DOF5.7(2)
-----HVH21            --------->ANAC58 --------->SPL7(1)               ---------->DOF2
--ZAP1         --------->ARR14(2)    ----------->HVH21               --------->DOF5.7(2)           -
--MYB46(3)     --------->ARR11(2)<---------ANAC58          <---------KAN1--------->DOF5.7(1)     <--
-DEAR3(1)  <---------LBD16       <---------ANAC58   --------->AtLEC2--------->TOE2(3)   <---------AtMYB61
 
aaccgtagacttggaccggaatggcaagcccttgttgctagggacggcgggagccatggagaacatagcagcgttaaaggtggccactgtgatggttttg  19656900
                    <---------At4g35610
                    ------>NtERF2
                 <---------ZAT2
                 <-------GAMYB
                 --------->ATERF1(1)
                 <---------ATERF1(1)
                 <------NtERF2
                 <---------At4g35610
                 --------->At4g35610
                 --------->ZAT2
                ------>NtERF2
                <---------ATERF1(1)
                <---------RRTF1(1)
                <---------MYB46(3)
                <---------RAP2.3(1)
                <---------ERF1                                                                 <----
               <---------ANAC58                                                                <----
               <---------ANAC46                                                                -----
               <---------RRTF1(3)                                                             ------
               <---------RAP2.3(3)                                                            ------
               <---------DREB2C(2)                                                        <---------ANAC46
               <---------RRTF1(2)                                                        <---------LBD16
               <---------RAP2.3(2)                                                      <---------WRKY18(1)
               <---------RAP2.6(2)                                                      --------->MYB52(1)
               <---------DEAR3(1)                                                     <---------WOX13(1)
               <---------ATERF1(2)                                                  <---------MYB46(3)
               --------->ATERF1(2)                                                  --------->MYB55(2)
               <---------ANAC58                                                    <---------AtMYB61
             <---------ATERF1(1)             --------->YAB5                     <---------DEAR3(1)
         --------->MYB55(2)                 <---------YAB1                      --------->ALFIN1<---
         <---------MYB46(3)               --------->YAB1                        <---------AtMYB61
        --------->ALFIN1                  --------->YAB5            <---------At4g35610----------->HVH21
      <---------ANAC58                   --------->ICU4             --------->At4g35610--------->WRKY12
      <---------ANAC58                   <---------YAB1  <------ZmHOX2a(1)    <---------MYB46(3)----
      <---------ANAC46        --------->ANAC58          --------->LBD16      <---------AtMYB61------
     <---------MYB46(3)     ---------->DOF2 --------->ICU4         --------->MYB52(1)<-------GAMYB
  --------->ALFIN1--------->ATERF1(1) <---------YAB1  <-----------RAV1(2)    <---------DEAR3(1)<----
-------->LBD16--------->RAP2.6(3)  --------->ICU4     <---------LBD16        --------->ALFIN1-------
-------LBD16<---------DEAR3(1)--------->ANAC58 <---------YAB1   --------->RVE1(2)<---------MYB46(3)
 
tccgggtttgggtggatggcggctgccgatgaaaagccattttgatgatgatgagtctcaggagaagaatcaactgagaggtggtggtggttgacggaga  19657000
                            <---------DEAR3(1)
                           <---------LBD16
                           --------->ATERF1(1)
                          <---------RAP2.3(1)
                          ------>NtERF2
                          <---------ATERF1(1)
                         <---------RAP2.3(3)
                         <---------DEAR3(1)
                   --------->ARR14(2)
                   --------->ARR11(2)
                   <---------ARR11(2)
                 --------->LBD16
                 <---------ATERF1(1)
                <---------DEAR3(1)
                <---------ANAC46
               <------NtERF2<---------ANAC46
               <---------LBD16
               --------->ATERF1(1)
              <---------RAP2.3(1)
            --------->ATERF1(1)
           ------>NtERF2 <---------RRTF1(3)
        <---------LBD16  <---------RAP2.3(2)
       <---------ANAC46 --------->ATERF1(1)
       <---------LBD16----------->HVH21
      <---------LBD16--------->ATERF1(1)                                      --------->WOX13(2)
   <---------GLK1(1)<---------ATERF1(1)                                       <---------WOX13(2)
   <----------DOF2 <---------ARR14(2)                                       --------->ICU4
  <---------ANAC58--------->ATERF1(1)                                      <---------KAN1
  <---------ANAC58<------NtERF2                                        ------>ZmHOX2a(2)
-----GLK1(2)<---------ABI4(1)                                         <------ZmHOX2a(2)
-----ARR14(2) <---------ORA47(2)                                --------->DOF5.7(1)
---->ARR14(2)<---------DEAR3(1)                <-------TEIL    --------->DOF5.7(1)           -------
--->GLK1(1)<---------ATERF1(1)      --------->ANAC58          --------->DAG2--------->AHL20(2)
--->KAN1--------->LBD16<---------ATERF1(1) <---------TOE2(3)  --------->DOF5.7(1)        --------->ZAT6
------ARR14(2)<---------ATERF1(1)   --------->ANAC58         ---------->DOF2--------->AHL25(3)
----->GLK1(2)<---------RAP2.6(2)  ---------->DOF2      =============================================
--->HSFB2a(1)<---------RAP2.3(2) <------ZmHOX2a(1)     ----------------->AGL3 <---------AHL12(2) ---
-----RVE1(2)--------->SPL7(1) <------NtERF2<---------------AtSPL8    <---------GATA12 <-------------
---->ARR10----------->HVH21<------NtERF2 <---------ATHB12    --------->DOF5.7(1)      ==============
 
ttctggctttccggggacggcggagacgacggcggaggaaagcaatgaggttcaacatactaaaaaaagggcgatcgcatttattaagtctaaaactagt  19657100
                                                   <----------DOF2
                                                  --------------->AGL15
                                              <---------GLK1(1)
                                              --------->GLK1(1)
                                             --------->GATA12
---->GT1                                     <---------RVE1(2)                                    <-
==MADS_MADS                                  <---------GATA12                                     --
------->DOF2                           --------->ARR11(3)       --------->CCA1(2)            <------
--AGL15 <----------DOF2            <---------At4g35610    --------->ANAC46                --------->ALFIN1
==================================================================MADS_MADS             <---------KAN1
 
aaaagtatatacttttgagttttgacaatgagagagagagatgatatagatttccttttatacgaagaaatgagagagagagagttgtggaatgtggagt  19657200
                                                             --------->RVE1(2)                     -
                                                           --------->ICU4                          <
                                                    <---------ANAC58                           <----
                                                    --------->TGA1a                            -----
                                                    <---------TGA1a                            -----
                                                    --------->O2                              ------
                                                    <---------O2                              ------
                                                    <---------ANAC58                        <-------
               <-----------HVH21                    <---------ANAC46                      ------->TEIL
              ----------->GT1                       <---------bZIP60(2)               <-------------
        ---------->DOF2                             <---------ANAC55(1)               --------------
        --------->DOF5.7(1)                         --------->ANAC55(2)               --------------
 --------->ZAT18          ====================================bZIP_DOF            <---------WOX13(2)
 <---------ZAT18   --------->At4g35610              <---------ANAC55(2)           --------->AHL12(2)
--------At4g35610  <---------At4g35610           <---------SPL7(1)                --------->WOX13(2)
------->At4g35610*TSS     <----------DOF2       <---------ANAC58      <---------YAB1<---------AHL20(2)
---ANAC46 --------->DOF5.7(1)                   <---------ANAC58      <---------YAB5<---------AHL25(3)
 
ttgctgcacaaaaaagaaggtcatatgagcttcttgggaaaatggtatttggcttacgtggcattatcaactcatcatcgatgttaataaatgtaccaaa  19657300
                                        <---------YAB1
                                       <---------AHL20(3)
                                       --------->AHL20(3)
                                       <---------AHL20(2)
                                     <---------YAB1
                               <---------YAB1
                            --------->AHL20(1)
                            --------->AHL20(2)
                            <---------AHL20(1)                   <------MYB83
                            <---------AHL20(2)              --------->YAB1
     <---------DOF5.7(1)    --------->AHL25(1)              --------->ATHB12
    <----------DOF2         <---------AHL25(2)              <---------ICU4
----->ZmHOX2a(1)            <---------AHL25(1)              <--------HAHB4
----------DOF2              <---------AHL20(3)             <---------ATHB12
-----ARR14(2)               <---------AHL25(3)             <---------YAB5
---->ARR14(2)               --------->AHL25(3)            ------>MYB83                           <--
---->RVE1(2)        <---------WOX13(2) <---------AHL25(2) ------>MYB46(1)                        ---
>MYB83              --------->WOX13(2) --------->AHL25(2)--------->WOX13(1)                      ---
>MYB46(1)         --------->ICU4  <---------YAB1        --------->MYB46(3)                      ----
--MYB59           <---------YAB1<-----------GT1         --------->AtMYB61           ----------------
--AtSPL8   <---------ANAC46 --------->AHL25(2)      --------->ZAT18          <---------AHL20(2) <---
->AtSPL8   <---------ANAC58 --------->AHL20(3)  --------->DOF5.7(1)        <----------DOF2    ------
->AtSPL3   <---------ANAC58--------->AHL12(2)  ---------->DOF2   <------MYB46(1)   <-----------GT1
 
tccttttcttttttgtgtgtcttaattgtattttattactattattttagaaaagcccaccaatcatttggtttcagtcttttattttccaatacagaaa  19657400
                                                                           --------->DOF5.7(2)
                                                                         ----------->GT1
                                                                  <---------YAB1
                                                                 --------->AHL25(2)
                                                                 <---------AHL25(2)
                                                                 --------->AHL20(3)
                                                                 <---------AHL20(3)
                                                                 <---------AHL12(2)
                                                                <---------ICU4
                                                                --------->ATHB51
                                         <---------GATA12       -------->ATHB1
                                         --------->GATA12       <--------HAHB4
-------ICU4                              --------->ARR11(3)     --------->YAB5
------>YAB5                            >>>>>>>>>GT-1            --------->YAB1
------>YAB1                         ----------->GT1            --------->AHL25(3)
----->ICU4                         --------->MYB59             <---------YAB1
->AGL1                             <---------TOE1(3)           --------->ICU4
------ATHB12                       <---------TOE2(3)---------->DOF2     ------->TEIL
--->GLK1(1)      <XXXXXXXXXXXXXXXXXXXXMIR415<---------HSFB2a(2)<---------ATHB51
 
tcatgaaatacagtatggtattctgtttttgttttgtttaggtaaatctcgaactaaaagtatacaattattatggacgttaaacaactacgaaggaata  19657500
                                                                                                ----
                                                                                              ------
                                          <---------WOX13(2)                                  <-----
                                          --------->WOX13(2)                                  <-----
                                          --------->AHL12(2)                             <---------AHL25(1)
                                          <---------AHL12(2)                             <---------AHL20(2)
                                         --------->YAB5                                  --------->AHL20(3)
                                         --------->YAB1                                  <---------AHL20(3)
                                         <--------HAHB4                                  --------->AHL20(2)
                                        <---------AHL20(2)                               --------->AHL25(3)
                                  <---------ARR14(2)          --------->MYB46(3)         --------->AHL25(1)
                                  --------->ARR14(2)        <-----------GT1           <---------ARR11(3)
                                  --------->KAN4(2)      --------->WOX13(2)           <---------RVE1(2)
                                 <----------TaMYB80  ----------->GT1 <---------------AGL15    <-----
                                 --------->KAN1    --------->DAG2    --------------->AGL15    ------
                         --------->DOF5.7(1)  <---------TOE2(3)     ----------------->AGL2    ------
           <-----------TGA1      <---------KAN1    --------->DOF5.7(1)    ---------->DOF2<---------AHL25(2)
           <-----------HVH21    <---------KAN4(2) ---------->DOF2   ----------------->AGL3  <-------
      --------->MYB46(3)--------->DOF5.7(1)  --------->MYB52(1)   ------->GAMYB       --------->ARR11(3)
     ------->TEIL      ---------->DOF2  <---------YAB1   <---------WOX13(2)--------->DAG2--------->AHL25(2)
 
ggtttatgaaccatcgtcagagaagagaaagggagcatattctataattaacgaaaaggaaattaacaactcccaaaaaaagttatagagattttatttt  19657600
   <---------TOE2(3)                <---------PCF2
----->AHL20(2)                      <-----------HVH21
--->AHL12(3)                       <------MYB83
----AHL12(3)          --------->AHL20(2)                        --------->WOX13(2)
----AHL20(2)          <---------AHL20(2)                        <---------WOX13(2)              <---
----AHL20(3)          --------->AHL12(3)                      ------>ZmHOX2a(1)               ------
--->AHL20(3)          <---------AHL12(3)        ----------->HVH21                 --------->RVE1(2)
--->AHL20(2)    ----------->GT1    <------MYB46(1)<---------RVE1(2)       <---------WOX13(2)--------
--YAB1       <---------AtLEC2     <---------MYB46(3)    ------->TEIL      --------->WOX13(2)--------
 
tatatataggtttaatgcatggtatatatatagctagtgggtcaggcctatttgacatggacctcctcattaaaactaattagactatcaatttcaagca  19657700
<- Previous    Next ->

AGI:  At2g48030.1   
Description:  endonuclease/exonuclease/phosphatase family protein. similar to endonuclease/exonuclease/phosphatase family protein [Arabidopsis thaliana] (TAIR:AT3G21530.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71059.1); contains InterPro domain Endonuclease/exonuclease/phosphatase (InterPro:IPR005135)
Range:  from: 19654593    to: 19657218    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version