AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   <
                                       --------->KAN1                                        <------
                             <---------ANAC58                                           ----------->GT1
                      <----------DOF2--------->KAN1                                 --------->ARR14(2)
                 --------->RAP2.6(3)----------->ARR10                  --------->LBD16  <------MYB83
                --------->ARR14(2)<---------ANAC58                    <---------ANAC55(2)   --------
                --------->MYB52(1)<---------ANAC58               ----------->HVH21  <---------ARR14(2)
           <---------ATHB12  <---------ANAC58       --------->YAB5<---------WRKY18(1)   <------MYB46(1)
 
actctcttgcagtaatcaagaacggctttgttgtttggcgagatgctcgagcccatgtttacttcggtttgacccgtgaagttagacgatttggttaatt  19333100
                                                                                             -------
                                                                                             <------
                                                                                            --------
                                                                                    <-----------HVH21
                                                                                 <----------DOF2  --
        <---------ANAC46                                                 --------->TGA1a  <---------KAN1
        <---------ANAC58                                                 <---------O2    --------->GATA12
<----------DOF2                                                          <---------TGA1a<-------GAMYB
---------DOF5.7(1)                                 <---------WRKY18(1)   ===================bZIP_DOF
---WOX13(2)     ---------->DOF2            ------>ZmHOX2a(1)             =======================MYC_MYB
->KAN1  <---------ANAC58         --------->ATHB12 ----------->HVH21      --------->O2 --------->ETT(1)
 
cgtcttttgtagcgagcatgaaagccttgatcagcttgtttgggtcctcgctcttgaccggctcgagagttttgacacatgaggctttgtcggatgtcga  19333200
       <---------ANAC58
       <---------ANAC58                                                          <---------GLK1(1)<-
  --------->KAN1                                                    --------->YAB5       -----------
-->ETT(2)                                                          --------->MYB46(3) ------>NtERF2
---ETT(2)        <----------DOF2                              --------->ANAC58   --------->At4g35610
->DDF1 <---------ANAC46  <---------LBD16        --------->ICU4--------->ANAC58   <---------At4g35610
--------->GT1--------->MYB46(3)    <---------GLK1(2)      <---------YAB1  ------>ZmHOX2a(1)   ------
 
ctggcaaattccttgaaccgctttcatttggggagacagattagcatcgccatttttgtttatgaaggcaacgactcctatggcaactccgactattaag  19333300
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                   --------->AHL25(1)                                       --------
                                   <---------AHL20(2)                                       --------
                                   --------->AHL12(3)                                      <--------
                                   --------->AHL25(2)                            <------ZmHOX2a(2)
                                   <---------AHL25(2)                           <---------ARR11(2)
                               <---------ICU4                                   <---------GATA12
         <------NtERF2         <--------HAHB4                                   --------->GATA12
        ------>NtERF2          --------->YAB1                                   --------->ARR14(2) -
      <---------ABI4(2)       <---------ATHB12      <------------------------ANAC81       <---------ARR14(2)
      --------->ZAT18         <---------YAB5      --------->AHL12(2)            <---------ARR14(2)<-
     --------->ATERF1(1)    --------->WOX13(1)  <------------------------ANAC81 --------->ARR11(2)<-
--------->ALFIN1      <---------DAG2           <---------MYB52(1)   <---------DOF5.7(1)   --------->GATA12
-----ZmHOX2a(1)       <----------DOF2   <------------------------ANAC81<-----------GT1    --------->ARR14(2)
---->AGL15            <---------DOF5.7(1) <-----------GT1          <----------DOF2      --------->LBD16
--->DOF5.7(1)   --------->AtMYB61 <---------DOF5.7(1)             <---------DOF5.7(1) <---------LBD16
 
aggatggaggccaccgagaccacaacttttccaatcatttttttttttctgtttttttttttttttggttcttttttctctccgatccctccggatttat  19333400
----AHL12(2)
----WOX13(2)                                                                  --------->GLK1(2)
--->WOX13(2)                                                                 --------->ARR14(2)
->AHL25(1)                                                                   <---------RVE1(2)
->ICU4                                                                       <---------ARR14(2)
--AHL12(1)                                                                   <---------GLK1(2)
->AHL12(1)                                                                <---------WOX13(1)
->AHL25(3)                                                           --------->YAB1
->AHL20(2)                                                         <------------CBF
-KAN1                           ---------->DOF2                <---------ARR11(3)--------->HSFB2a(2)
---------->GT1          --------->WOX13(2)                     --------->GLK1(2) <---------HSFB2a(2)
--------TOE1(3)         <---------WOX13(2)                     --------->RVE1(2)<---------LBD16
--------TOE2(3)      <----------DOF2            <---------WOX13(1)*TSS <---------YAB1    <----------
 
taaggttaatcggagagggagaggctttattagattaaagccaaattgttgaatgacttaggccagtatctattgtgatggattctggaggtttatatag  19333500
                           <---------ANAC58
                           <---------AtLEC2                     --------->MYB46(3)        --------->DAG2
                           <---------ANAC58                  <---------WRKY45            ===========
                           <---------ANAC46                  <---------WRKY38(1)   <------MYB46(1)
                       <---------ANAC58                      <---------WRKY12      <------MYB83
           <---------------AGL15                            --------->WRKY18(1)    ----------->GT1
           --------------->AGL15                     <---------RVE1(2)         <---------ARR14(2)
          ----------------->AGL3      <---------AtLEC2     <-----------HVH21  --------->AHL12(1)
          ----------------->AGL2      <---------ANAC58     <---------PCF2     <---------KAN1  <-----
          <-----------------AGL3      <---------ANAC58  --------->ALFIN1      <---------AHL12(1)  --
<---------DAG2         <---------ANAC58           <---------WOX13(1)   <---------ANAC46  ---------->DOF2
<----------DOF2   ----------->GT1     <---------ANAC46<-----------RAV1(1)    --------->GLK1(2)======
-TBP      <-----------------AGL2<---------RVE1(2)<------------CBF   <---------KAN1--------->MYB59 <-
 
aagctttttgaattctaaaattagtaacttgcatggattttgcatggagagggattgatgtgggtcaacgaatggctgagaatatttggtcaaaaagctt  19333600
                      <---------bZIP60(2)
                      --------->bZIP60(1)
                      <---------bZIP60(1)
                      --------->TGA1a
                      <---------TGA1a                              <-----------ARR10
                      <---------ANAC46                             <---------ARR11(1)
                      <---------O2                   --------->WOX13(2)     <---------TOE2(3)
              <---------At4g35610                --------->TOE2(3) --------->ARR14(2)
    <----------DOF2   ========================bZIP_DOF       --------->ARR11(2)
    ============================bZIP_DOF        --------->ANAC58   <---------ARR11(3)
 <-----------GT1      --------->O2              ----------->GT1    <---------GATA12
<---------AHL20(2)  <---------TGA2(2)           --------->ANAC58   --------->GATA12         <-------
<-----------GT1    ----------->HVH21           ------->TEIL  <---------ARR14(2)         <---------MYB52(1)
================================bZIP_DOF      --------->MYB52(1)   --------->RVE1(2)   --------->TOE2(3)
-----DOF2     <---------ZAT2           <------ZmHOX2a(1)     <---------ARR11(2)       --------->ANAC55(2)
------->WOX13(2)   ----------->TGA1  --------->DOF5.7(1)     --------->ARR14(2)      <---------TOE2(3)
================================bZIP_DOF     <---------SPL7(1)    <---------CCA1(2) <-----------GT1
--------WOX13(2)  <-----------HVH21---------->DOF2   <---------WOX13(2)    --------->MYB52(1)
 
tatttaactttcgctggagctcgtgacgtcgaacttagaaaaggatgccgaacgtaaatttgcagttccaaatcttactaagggtatttacgttatttca  19333700
                                                                                                 <--
                                                                                                 ---
                                                                                               <----
                                                                                               <----
                                                                                         <---------TOE2(3)
                                                                                   <---------------AGL15
                                                                                   --------------->AGL15
                                                                                  ==================
                                                                                  ------>ZmHOX2a(2)
                                                                                  <-----------------AGL2
                                                                                  ----------------->AGL3
                                                                                  <-----------------AGL3
                                                                                  ==================
                                                                                  <-----------------AG
                                                                                  ----------------->AG
                                            --------->ATHB12                      ----------------->AGL2
                                      --------->YAB1 ====================================HOX2a_HOX2a
                               <----------DOF2--------->ICU4           ----------->GT1--------->ARR14(2)
     <-------TEIL           <-----------GT1 <---------ICU4           <-----------RAV1(2) <---------YAB1
  <---------ANAC58      <------ZmHOX2a(1)  <---------YAB5          <-----------HVH21  <---------ARR14(2)
  <---------ANAC58    <---------TOE2(3)  --------->YAB1 <---------YAB1 <---------At4g35610     -----
----GT1            <---------KAN1    <---------YAB1  ------>ZmHOX2a(1) --------->At4g35610----------
 
atcttacgtccatatatatggaatttaggattaactttctataatagtcattagtccttactataaacaaggtcaggtgaaatgatccaaatatggttaa  19333800
           --------->RVE1(2)
        --------->AHL12(2)
        <---------AHL12(2)
       <---------AHL20(2)
      <---------AHL20(2)                        <---------KAN1
      --------->AHL25(3)                        <---------GLK1(1)
      --------->AHL20(2)                   --------->DOF5.7(1)
-------AHL12(1)                           --------->MYB52(1)                                 -------
------>AHL12(1)                      --------------->AGL15                        <---------YAB1
-----AHL12(2)       <-----------GT1  <---------------AGL15                        <---------TOE2(3)
-----WOX13(2)     --------->AHL12(1)<-----------------AGL2                  <---------AHL20(1)
=====================================================MADS_MADS              --------->AHL20(1)  ----
=====================================================MADS_MADS             --------->AHL12(2)<------
---->AHL12(2)     <---------AHL12(1)<-----------------AGL3            ----------->GT1       <-------
->GT1--------->AHL12(2)    <---------ANAC55(2) <---------RVE1(2)      <---------ZAT6  ----------->GT1
 
tttttcttatttattatctaatttttcattacttaaaattctaaataagggatttgtgtaacaaatcgacattgtgttatatattaagtttgtgaaaatc  19333900
                                                                                                 ---
                                                                                            --------
                                                                                            --------
                                                                                            <-------
       <---------WOX13(2)                                                                   --------
       --------->WOX13(2)                                                                   <-------
    <---------YAB1                                                                          --------
  <---------ICU4                                                                            <-------
  --------->YAB1                                                                            --------
 <---------YAB5            --------->MYB52(2)                                               <-------
 --------->ICU4          <---------MYB52(1)                                               <---------AHL12(2)
<---------WOX13(2)       <--------P                                                      <---------WOX13(2)
--------->WOX13(2)     --------->YAB5                  <---------AHL20(2)               --------->AHL12(1)
-->RVE1(2)             <---------MYB46(3)  --------->RVE1(2)                        ----------->GT1
----->TOE2(3)         <---------ATHB12    <---------CCA1(2)                  <---------------AGL15
---ARR14(2)   <---------YAB1              <---------KAN1  <----------DOF2    --------------->AGL15 >
--GLK1(1)     --------->ICU4     <-----------GT1       <-----------GT1  --------->KAN1  <---------AHL12(1)
 
cctaattatcaattgacattattcaatggttagtttttacatcgtatatcaaacgtattaactttctattacttcaaattctaaaaattgaaaatttaaa  19334000
<- Previous    Next ->

AGI:  At2g47030.1   
Description:  VGDH1; pectinesterase. Identical to Pectinesterase-4 precursor (PME4) [Arabidopsis Thaliana] (GB:O80722;GB:Q5MFV7;GB:Q8H194;GB:Q9T0P8); similar to VGD1 (VANGUARD1), pectinesterase [Arabidopsis thaliana] (TAIR:AT2G47040.1); similar to VGDH2 (VANGUARD 1 HOMOLOG 2), pectinesterase [Arabidopsis thaliana] (TAIR:AT3G62170.1); similar to Pectinesterase (Pectin methylesterase) (PE) (GB:Q42608); similar to Probable pectinesterase precursor (Pectin methylesterase) (PE) (GB:P41510); similar to pollen development related protein [Brassica rapa subsp. chinensis] (GB:ABC25451.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains In
Range:  from: 19331303    to: 19333467    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version