AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          --------->ARR11(3)
          <---------ARR11(3)                           --------->YAB1            --------->TOE1(2)
      ---------->DOF2                                  ----------->GT1           --------->TOE2(2)
--------->KAN1                                       <---------WOX13(2)         --------->ANAC46
--------->At4g35610                             ----------->GT1     --------->TOE1(3)  --------->GLK1(1)
---->ANAC46                                   <---------MYB52(1)    --------->TOE2(3)  <---------GLK1(1)
---->ANAC58                    --------->At4g35610   --------->WOX13(2)--------->MYB52(2)         --
---->bZIP60(2)         --------->TOE1(3) --------->RVE1(2)  <---------WOX13(2)  --------->ANAC58  <-
---->ANAC58            --------->TOE2(3) --------->GLK1(2)  --------->WOX13(2)  --------->ANAC58----
 
gtcatatgcaaaagaactcacaaaaaccttaggcatcttaagaaaatccatttgttaattgtaaattgaaaccttagttccaaacgtaagaattctgaat  18871400
         <---------AHL12(1)
         --------->AHL12(1)
         <--------ATHB1
         -------->HAHB4
         <---------ICU4
         <---------AHL25(3)
         --------->YAB5                                                            ---------->DOF2
        <---------YAB5                                                      --------->AHL20(2)
        <---------YAB1                                                    ----------->GT1
        --------->ICU4                                                   ------->TEIL
        <---------ATHB51                                                 <---------TOE2(2)
       <---------AHL20(3)                                             ========================bZIP_DOF
       --------->AHL20(3)                                             ========================bZIP_DOF
       --------->AHL12(2)      ------->TEIL                           --------->ANAC58
       --------->AHL12(3)      --------->ARR11(2)                     --------->ANAC46
       --------->AHL25(2)      <---------ARR14(2)                     ==============================
       <---------AHL25(2)      --------->ARR14(2)                     --------->TGA1a
      --------->YAB1           <---------ARR11(2)                     <---------TGA1a <---------At4g35610
     <---------YAB1          --------->YAB5                           --------->ANAC58--------->At4g35610
------->ANAC55(2)       <---------YAB1         --------->YAB5         --------->ANAC55(2)       ----
--------ANAC55(2)    --------->ICU4   ------>ZmHOX2a(1)               --------->ANAC55(1)       <---
----->AHL20(2)       <---------YAB5------>ZmHOX2a(1)<---------TOE2(3) <---------ANAC55(2)   <-------
 
tacatactataataattcatcgtaaacatgaatgaatcctcctaagtagaagattaacatatataaaacacacacgtatgtaaatagaaagcttactttc  18871500
                                                                             <---------ARR11(2)
                                                                             --------->ARR11(2)
                                                                             <---------ARR14(2)
                                                                           <------MYB46(1)
                                       <---------AHL12(2)                  <---------DEAR3(2)
                                <---------RVE1(2)                          <------MYB83   --------->At4g35610
                             --------->ALFIN1                             <---------DEAR3(1)
           <----------DOF2 <---------ANAC46                    --------->LBD16            <---------At4g35610
        --------->ARR11(3) <------MYB83------->TEIL        <---------ALFIN1<---------MYB46(3)
  ------->GAMYB            <------MYB46(1)           ------>NtERF2    <------ZmHOX2a(1) <------NtERF2
==========MYC_MYB         <---------AtMYB61        --------->LBD16 <-----------RAV1(2) --------->LBD16
----->HSFB2a(2)           <---------DEAR3(1)     <---------LBD16  --------->ZAT2      --------->DEAR3(1)
------HSFB2a(2)    ----------->HVH21<---------YAB1--------->ANAC46<---------ZAT2     <---------LBD16
---DOF2 <---------ARR11(3)--------->ALFIN1    --------->KAN1 <---------LBD16 --------->ARR14(2)
 
tacaacggcaagagctttggactcgacgggaggtggattatgaattttctcatccgcgacttccaccggagcaggagtcggttccttcgccggagctaaa  18871600
             --------->TOE2(3)
            --------->ANAC46             --------->LBD16
       <---------------AtSPL3            ------>NtERF2
       --------->GLK1(2)                --------->ANAC46                                <---------ANAC58
      <---------GLK1(2)                 --------->ANAC58                                <---------ANAC55(1)
      <---------GATA12                  --------->DEAR3(1)               <---------GATA12--------->LBD16
     --------->GLK1(1)       <----------DOF2                             <---------ARR11(3)
     --------->KAN1<---------MYB59      --------->ANAC58                 <---------GLK1(2)
     --------->HSFB2a(1)    <---------DOF5.7(1)                          <---------RVE1(2)
    ----------->ARR10--------->KAN1    <---------LBD16           >>>>>>>>>TBF1          <---------ANAC58
   <------NtERF2   <---------DOF5.7(1)<---------ATERF1(1)     >>>>>>>>>TBF1             <---------ANAC46
  --------->LBD16  --------->TOE2(3)  ------>ZmHOX2a(1)--------->At4g35610             <---------LBD16
<---------LBD16<---------WRKY12      <---------ALFIN1  <---------At4g35610  <---------AHL20(2)   ---
 
acagccggagattctacgtcaaccttactcgtcttttgctcctccgccattgtctctcagccgaagaagaagaacagattttatgttttttccgtgaaaa  18871700
                       --------->YAB5
                       <---------ICU4                  <---------At4g35610--------->SPL7(1)
          --------->ARR11(3)                        --------->DOF5.7(2) <---------ZAT18
          <---------RVE1(2)                         <---------MYB52(1)  --------->ZAT18
          <---------ARR11(3)   ---------->DOF2     <-------GAMYB        <---------ZAT14
        <---------TOE2(3)<---------YAB5         ------>ZmHOX2a(1)       <---------SPL7(1)
  <---------AHL20(3)   --------->YAB1       <---------ARR14(2)         <---------ANAC58
  <---------AHL20(2)  <---------ATHB51      --------->ARR14(2)         <---------ANAC58
 --------->AHL25(3)   <---------ATHB12      --------->ARR11(2)    --------->ALFIN1
 --------->AHL20(2)   --------->ICU4       --------->KAN1        <---------------------WRI1
-------->GT1     <------ZmHOX2a(1)         <---------CCA1(2)    *TSS <---------ANAC46     <---------ICU4
 
tggataaaattgagattttaggacaataatgagttaaagagtttttatatcctccgttagcttataccggtggagcgtactacgcgcgtttaataagtgt  18871800
                                                                                   <-------MYC2
                                                                                   <-------MYC3
                                                                                   ------->MYC3
                                                                                  <---------O2  ----
                                                                                  --------->ANAC55(2)
                                                                                  --------->ANAC58
                                                    ---------->DOF2               <---------TGA1a
                                                    ========================================bZIP_DOF
                                                 <----------DOF2                  --------->ANAC58
                                               --------->At4g35610                --------->O2  ----
                                               <---------At4g35610                <---------ANAC55(2)
                                             <---------DEAR3(1)             <-----------HVH21   ----
                                             <---------RAP2.6(2)           <---------ANAC58   <-----
                                            --------->SPL7(1)              <---------ANAC58   ------
                                         <---------ANAC58                 <-------TEIL  --------->AHL20(2)
                          --------------->AtSPL8 ===========================================bZIP_DOF
                      <---------RVE1(2)  <---------ANAC58            ----------------------->TaNAC69(2)
                   <---------MYB52(1)    ------>ZmHOX2a(2)      --------->ANAC55(2)------->MYC2 ----
           <---------ANAC58            <---------RVE1(2)        --------->ANAC58  --------->ANAC46<-
           <---------ANAC58   ------->TEIL<---------SPL7(1)     --------->ANAC58  ==================
--------->GLK1(2) <-------GAMYB      ----------->HVH21          --------->ANAC46  --------->TGA1a --
 
gagactcttgttttgcttcgccgttgatttttgtacccatgtgatcgtgcggctgtaaagctctcatacgcattggatgcgttacacgtgattaaacaca  18871900
                                   ----------->HVH21
                                   --------->TGA2(2)
                                  <-----------HVH21
                                  <-----------TGA1
                                 --------->ANAC55(1)
                                 --------->bZIP60(2)
                                 <---------O2
                                 <<<<<<<<<<HY5
                                 ============================================bZIP_DOF
                                 <---------bZIP60(1)
                                 --------->bZIP60(1)
                                 <---------ANAC55(2)
                  ----------->GT1--------->ANAC55(2)
                  <---------MYB46(3)
      <---------RAP2.6(3)        --------->O2
      ------>NtERF2              --------->ANAC46
     --------->ATERF1(2)         --------->ANAC58
     <---------ATERF1(2)         <---------TGA1a
     --------->RAP2.6(2)        <-----------bZIP910(1)
     --------->At1g77200  --------->YAB5                                     --------->KAN1
     <---------ETT(1)     --------->YAB1                                    <---------RVE1(2)
     <---------ETT(2)    <---------ATHB12                                 ------>ZmHOX2a(1)
----->ANAC58  --------->DAG2    <-----------bZIP911(1)            <----------DOF2
----->ANAC46  --------->DOF5.7(1)--------->ANAC58                <---------DOF5.7(1)
----->bZIP60(2)  --------->ALFIN1--------->TGA1a                <---------DOF5.7(1)
----ALFIN1--------->ANAC58<---------ICU4                      <---------DOF5.7(1)
--->ANAC46--------->ANAC58<------------ATHB5                 <---------DOF5.7(1)
----->ANAC58 ==============================bZIP_DOF       ------>ZmHOX2a(1) <---------ARR11(3)
--------ZAT14<---------ZAT14--------->bZIP60(1)        ---------->ID1     --------->LBD16
========================bZIP_DOF<-----------STF1  --------->AHL12(2)  <-----------GT1
------->ZAT14---------->DOF2<---------bZIP60(1)  --------->AHL12(1)<---------DOF5.7(1)   --------->TOE2(3)
 
cctcactgccgacaagtaaagtggttcaatgatgccacgtcacctctgtagaaaatttgtcctccccttcttttttcctgatattcaacaaaacttaatt  18872000
                  --------->AHL12(1)                                      <---------AHL12(3)
                  <---------AHL12(1)                                      <---------AHL20(3)
                  --------->AHL25(2)                                      --------->AHL25(1)
                  <---------AHL25(2)                                      --------->AHL20(3)
                  --------->AHL20(3)                                      <---------AHL20(2)
           ------>MYB46(1)                                               --------->AHL12(1)
           ------>MYB83                          ----------->GT1 --------->ZAT2
         <---------MYB59          <---------AHL25(3)             <---------ZAT2    <---------YAB1
        --------->ANAC46         --------->AHL25(3)              --------->At4g35610
      <-----------GT1            --------->AHL25(1)              <---------At4g35610               -
    --------->YAB1<---------AHL20(3)   ----------->GT1     <---------GLK1(2)     --------->YAB1   <-
   <---------ATHB51              <---------AHL20(2)        <---------RVE1(2)    <---------YAB1    <<
   <---------ATHB12              --------->AHL12(3)        --------->GATA12  <---------AHL20(2)  ---
  <---------WOX13(2)             --------->AHL20(2)   --------->RVE1(2)<---------RVE1(2)        ----
  --------->WOX13(2)      <-----------GT1    <---------YAB1<---------GATA12  <---------YAB1    -----
 
cttccaattataccgaactaaaattttgtttaccatataaattggtttaaaattgaaaatcagattttagctgggatttttttattatgagaaaaacaac  18872100
                                --------->ATHB51
                               <---------AHL25(1)
                               <---------AHL20(2)
                        <---------ARR11(3)
                   <---------AHL20(2)
                   <---------AHL25(3)
                  <---------AHL25(1)
                  --------->AHL25(1)                                                --------->WOX13(2)
            --------->ANAC58   --------->AHL20(3)                                   <---------WOX13(2)
            ----------->GT1    <---------AHL20(3)                               <-----------------AGL3
          --------->YAB1--------->ARR11(3)                                      <-----------------AGL2
         <---------ATHB12 ------>ZmHOX2a(2)        --------->WOX13(2)         --------->RVE1(2)<----
-------->YAB1     <---------AHL20(2)           <---------ANAC58     <---------AHL20(2)       <------
--------ATHB12    <---------AHL12(3)      <---------ICU4---------->DOF2       <---------GATA12 -----
<<<<<<<ARR2 --------->ANAC58   <---------YAB1  <---------ANAC58     --------->AHL20(2)       -------
------>RVE1(2)    --------->AHL20(2)    --------->GLK1(2)    <-------TEIL     --------->GATA12 <----
----->WOX13(1)   --------->AHL12(2)     <-----------ARR10--------->DAG2       ------->TEIL<---------ANAC58
---->MYB46(3) --------->AHL20(2)--------->ATHB12   <---------WOX13(2)<---------AHL12(2)   <---------ANAC58
 
aatcaaactacaatcaagaaaataaatgatctatattattgctaatcttggcttaactaaaaagttcgtattaaaaaactgaatctaaatttggagtgag  18872200
                                                                                   <---------YAB1
                                                                                  <---------AHL25(3)
                                                                                  --------->AHL20(1)
                                                                                  --------->AHL25(2)
                                                                                  <---------AHL25(2)
                                                                                  <---------AHL12(2)
                                                     --------->RVE1(2)            <---------AHL12(3)
                                                   <---------AHL12(1)             --------->AHL20(3)
                                                   --------->AHL12(1)             <---------AHL20(3)
                                                  <---------AHL12(2)             <--------HAHB4
                                                  --------->AHL12(2)             <---------ICU4
                                                <---------AHL20(3)               --------->AHL12(1)
                                     <---------AHL25(3)                          <---------AHL20(2)
                             --------->ALFIN1   --------->AHL20(1)               --------->ATHB51
                             <---------KAN1     --------->AHL25(3)               --------->AHL20(2)
                             <---------ANAC46   --------->AHL25(2)               --------->AHL12(3)
                           <---------ANAC46     <---------AHL20(1)               <---------AHL12(1)
                           <---------ANAC58     <---------AHL25(3)               --------->AHL25(1)
                           <---------ANAC58     <---------AHL25(2)               --------->AHL25(3)
                           <-------GAMYB        <---------AHL25(1)               <---------AHL25(3)
                          <---------MYB46(3)    --------->AHL20(2)               -------->ATHB1
                         <---------ANAC58       --------->AHL20(3)               --------->YAB1
                         <---------ANAC46       --------->AHL25(1)               <---------AHL25(1)
                         --------->ETT(1)       <---------AHL20(2)              --------->AHL25(3)
-----At4g35610           <---------ANAC58    --------->YAB1                     <---------ATHB51
---ZAT18               <-----------HVH21    <---------YAB1 --------->KAN1--------->AHL20(2)
---->At4g35610        <---------KAN1 <---------AHL20(2)    --------->YAB5<---------AHL20(2)
-->ZAT18              --------->ALFIN1 --------->GATA12   <---------ATHB12      --------->ICU4     <
-----ZAT2     ----------->HVH21     --------->AHL20(2)  --------->WOX13(1)    --------->YAB5     <--
 
ctcgtatgcctatagaattgacagagtgtcgggtgtgtattaaatctataataaaatatcaatcactcgaattcatttaaacaattattttagttttaaa  18872300
<- Previous    Next ->

AGI:  At2g45820.1   
Description:  DNA-binding protein, putative. Identical to Remorin (DBP) [Arabidopsis Thaliana] (GB:O80837;GB:Q39087); similar to DNA-binding family protein / remorin family protein [Arabidopsis thaliana] (TAIR:AT3G61260.1); similar to unknown [Populus trichocarpa] (GB:ABK92585.1); contains InterPro domain Remorin, C-terminal region (InterPro:IPR005516); contains InterPro domain Remorin, N-terminal region (InterPro:IPR005518)
Range:  from: 18870027    to: 18871765    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version