AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                     <---------ANAC58
                                     <---------AtLEC2
                           <---------ANAC58
                           <---------ANAC46
                           <---------ANAC58
      <-----------HVH21   <-------TEIL
   ----------->RAV1(2)<---------YAB5 <---------ANAC58                            <---------ANAC46
   ===============================RAV<---------ANAC46             --------->At4g35610        -------
----->GT1             <-----------RAV1(1)                         <---------At4g35610       <-------
 
taaaacacctgtcaataccattctaatggtgcgtcaagttgcatgaaaacaatgctacaatgtttgtgaagcagaacaatggctaagtgtatgatgtatc  18692800
                                                                                           <--------
                                                                                           ---------
                                                                                   ------>ZmHOX2a(2)
                                                                                  <------ZmHOX2a(2)
                                                                                  --------->CCA1(2)
                                                                                 <---------AGP1
                                                                                 --------->ARR11(2)
                                                                                 <---------ARR11(3)
                                                                                 --------->AGP1
                                                                                 --------->RVE1(2)
                                                                                 <---------ARR14(2)
                                                                                 <---------ARR11(2)
                   ---------->DOF2      --------->CCA1(2)                        <-----------ARR10
             <---------AHL20(2)  <-------TEIL                                    --------->GATA12
             --------->AHL20(2)--------->GATA12                                  <---------GATA12---
           <---------YAB1  --------->LBD16--------->O2                           <---------RVE1(2)
        <---------YAB1     ------>ZmHOX2a(1)                                     --------->ARR11(3)
      --------->YAB5      --------->TOE1(2)                                      --------->ARR14(2)
>TEIL ----------->GT1  --------->ARR11(3) <---------O2         <---------ANAC58 <---------CCA1(2)---
--CCA1(2) <---------WOX13(2)   <---------GATA12                <---------ANAC58----------->ARR10----
 
tcattcaaatggttattaaaacaaaagttcctgagattcacagagacgagacattgtgttcaaattgctggacaaaattgctcagatctgtgcctataca  18692900
                                         --------->GLK1(2)
                                         --------->GATA12
                                         <-----------ARR10
                                         <---------GATA12
                                   --------->ANAC58
                                   <---------ANAC55(2)
        <---------REM1(1)        <---------KAN1
      <---------WOX13(2)        <---------ARR11(2)
      --------->WOX13(2)        <---------ARR14(2)                                 --------->ZAT2
   <----------DOF2              --------->ARR11(2)                                 <---------ZAT2
-ARR11(2)                       --------->ARR14(2)                                 <---------At4g35610
>ARR11(2)          --------------->AGL15 <---------ARR11(3)             --------->ANAC58  <------ZmHOX2a(1)
------>DAG2        <---------------AGL15 --------->RVE1(2)       <------ZmHOX2a(2) --------->At4g35610
------>DOF5.7(1)  --------->TOE1(3)--------->ANAC46     <---------ATHB12--------->ANAC58  ==========
------>DOF2       --------->TOE2(3)--------->ANAC58 <------NtERF2================================HOX2a_HOX2a
 
aaagtgcttaattgtagcaaacctaaaaatagaagaatacgcaaaatctaacctcggcaatgaaatcgatcagacaagccttgtccagctacaggaccga  18693000
                                                      --------->GATA12
                                                      <---------GATA12
                                                      <---------ARR11(2)
                                                      --------->GLK1(2)
                                                      --------->ARR14(2)
                                                      <---------ARR14(2)
                                             --------->TOE2(1)
                                            ------>ZmHOX2a(1)
                <---------YAB1       <------NtERF2    --------->ARR11(2)
             <---------ARR11(3) <---------LBD16       --------->RVE1(2)                           --
        ======================HOX2a_HOX2a  <---------ANAC46                                     ----
        ------>ZmHOX2a(2)  <---------MYB46(3)--------->TOE1(1)                               >>>>>>>
      <---------GATA12 <------ZmHOX2a(1)--------->ARR11(2)        --------->RVE1(2)      <------ZmHOX2a(1)
===============HOX2a_HOX2a<---------YAB5<---------ARR11(2)--------->LBD16          --------->CCA1(2)
 
gcacaaggtgatccaatttcttattaggaatggttcgcgcgtcgttcctcgtagccgaatccgaagaaaaatcaacaagtgaagagagatgaggaagaag  18693100
                                             ------>ZmHOX2a(2)
                                            <------ZmHOX2a(2)
                                           <-----------ARR10
                                           <---------ARR14(3)
                                           --------->ARR11(3)
                                           <---------AGP1
                                           --------->ARR14(2)
                                           <---------GATA12
                                           --------->RVE1(2)                   <---------YAB1
                                   --------->LBD16                            --------->YAB1   -----
          --------->ICU4           --------->At4g35610                        --------->AHL20(2)
          <---------KAN1      --------->DEAR3(1)                   <---------HSFB2a(2)         -----
 --------->ZAT14            ------>NtERF2  <---------ARR11(3)      --------->LBD16       <----------
 --------->ZAT18           --------->ANAC58--------->GATA12        --------->HSFB2a(2)--------->ARR14(2)
 <---------ZAT14---------->DOF2   --------->ANAC46         --------->GLK1(2)  <---------AHL20(3)
------->DOF5.7(1)          --------->ANAC46--------->ARR14(3)     <---------LBD16     <---------TOE1(2)
------>DOF2 <---------ANAC55(2)<---------SPL7(1)        <---------MYB52(1)    --------->AHL20(3)
>>TBF1 <------ZmHOX2a(1)   --------->ANAC58<---------ARR14(2)    <---------LBD16      <---------ARR14(2)
 
aaagagcacaggaataagtaaaagaattcgacgccatccgctacaagatctcatgctccgataatctctccgggaacccattaatatcgtattttcaacc  18693200
                           --------->LBD16
                         --------->At4g35610
                         --------->LBD16
                       <---------LBD16
                     --------->GLK1(2)
                     --------->GATA12
                     --------->ARR14(2)
                     <---------GATA12                                                     ----------
             ============================HOX2a_HOX2a                                      <---------ANAC58
             =========================HOX2a_HOX2a                                         <---------ANAC46
             <------ZmHOX2a(2)                                                            <---------ANAC58
          --------->DEAR3(1)   <------ZmHOX2a(1)                                       ----------->HVH21
       ------->GAMYB <---------ARR14(2)                                                ----------->TGA1
  ------->GAMYB      ------->TEIL <------ZmHOX2a(1)                                  --------->O2
 --------->ANAC58    --------->ARR11(2)                                              --------->ANAC46
 --------->ANAC58    <---------ARR11(2)                                              <---------ANAC55(2)
 --------->ANAC46 *TSS<---------KAN1  --------->YAB5                --------->LBD16  <---------ANAC58
---->TOE2(3)--------->RVE1(2)--------->ALFIN1                      <---------LBD16   --------->ANAC55(2)
---->TOE1(3)<---------GATA12<------NtERF2         ----------->RAV1(2)                <---------ANAC58
-GT1  --------->MYB46(3) <---------LBD16    ----------->HVH21     <---------LBD16    <---------O2
 
ttcaacgcaatcgccgatcaaacgaatccgcggaggaggactgactactgaccgcctgaaaaaaactaaaccgggaagaacccaaactacgtgacgttta  18693300
                              --------->WOX13(1)
                            <---------YAB5
                          --------->bZIP60(2)
                          --------->bZIP60(1)
                          <---------bZIP60(1)
                      ------>NtERF2
                      <---------RAP2.6(3)
                      <-----------HVH21                     ---------->DOF2
                     <---------ANAC58                  --------->YAB1
              --------->ARR11(3)                      <---------YAB1            ------->TEIL       <
              <---------ARR11(3)                  <----------DOF2       --------->ANAC55(2)       <-
    <-----------HVH21<---------ANAC58         <---------ZAT18           <---------ANAC55(2)------>ZmHOX2a(1)
->GT1        <---------KAN1<-----------TGA1   --------->ZAT18 --------->DOF5.7(1)         --------->TOE2(3)
 
tttgaactgtcatcgaatatcatgccgtctcgtcattcacttatctgagtgggctttataatagaaaggcccagtacataatgtatatcgattcctaagt  18693400
                            <-----------HVH21
                            <-----------TGA1
                           --------->bZIP60(1)
          <-----------RAV1(1)<---------YAB5
         *TSS     <---------ANAC58                           <---------ZAT2
     <---------ANAC55(2)   <---------bZIP60(1)               --------->ZAT2
     --------->ANAC55(2)   <---------TGA2(1)                 <---------At4g35610
   <---------KAN1 <---------ANAC46                   <----------DOF2
  <---------ARR14(2)       <---------ETT(2)    ------>ZmHOX2a(1)           <---------HSFB2a(2)
  --------->ARR11(2)       --------->ETT(2)    --------->At4g35610         --------->HSFB2a(2)
  <---------ARR11(2)    <-----------RAV1(1)    <---------At4g35610         --------->HSFC1(1)      <
  --------->ARR14(2)  --------------------->WRI1 ----------->HVH21         <---------HSFC1(1)   <---
---------ANAC46   <---------ANAC58        <---------DOF5.7(1)--------->At4g35610         ------>ZmHOX2a(1)
-----NtERF2   <---------At4g35610        ------>ZmHOX2a(1)<---------At4g35610          ----------->RAV1(2)
 
tggcgaatacataatgttgctgcgtctctgtcgtcatcgacttcctcttcctctgactttgagcagctctgtcttcttctcgaaatcgtctcctgtttct  18693500
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                             <------
                                           <---------KAN1                                    -------
                                     --------->RVE1(2)                                       <------
                                     <---------ARR11(3)                                      <------
                                     <-----------ARR10                                       -------
                                     --------->GATA12                                        -------
                               <---------HSFB2a(2)                                           <------
                               <---------HSFC1(1)                                            -------
                               --------->HSFC1(1)                                            -------
    <---------AtLEC2           --------->HSFB2a(2)                      ----------->GT1      -------
 <----------DOF2  <---------GATA12   --------->ARR11(3)        <---------ZAT18       <---------AHL12(1)
---------At4g35610--------->RVE1(2)  --------->GLK1(2)         <---------ZAT14       --------->AHL12(1)
------At4g35610   --------->GATA12   <---------GATA12          --------->ZAT14   <---------YAB1
 
tctgctttcatggatgcttcaaatcccaattcttctagaaaatctaatgtctcttccttcgctcagtccagtcgaaggtgaattctaatttttcaaatta  18693600
                                                                                            <-------
   ----------->GT1                                                                          --------
  --------->DAG2                                                                           <--------
 ---------->DOF2                                                                           ---------
----AHL12(1)                                                                               <--------
----AHL25(3)                                             <---------RVE1(2)                 ---------
--->AHL12(1)                                     <---------ANAC58                          <--------
--->KAN1                                         <---------ANAC46                         <------ZmHOX2a(1)
---AHL12(1)                                      <------MYB83                             ==========
-->AHL12(1)                                      <------MYB46(1)                       <------ZmHOX2a(1)
---AHL25(2)                                      <---------ANAC58                      =============
---AHL25(1)                                     <---------AtMYB61            --------->MYB55(2)
-->AHL25(3)            <-----------GT1          <---------MYB46(3)           <---------MYB46(3)
-->AHL25(2)         <---------RVE1(2)           --------->MYB111(1)<---------GATA12  --------->ALFIN1
---ATHB51 --------->RVE1(2) <---------TOE1(2)   --------->MYB46(2) <---------RVE1(2)================
-->AHL25(1)       <---------YAB1           <---------TOE1(3)    <---------WOX13(1)  <------ZmHOX2a(1)
-->AHL20(3)    <----------DOF2  <---------DOF5.7(1) <---------MYB46(3)      <---------AtMYB61 <-----
-->AHL20(2)   <---------DOF5.7(1)          <---------TOE2(3) <---------YAB1 --------->ALFIN1<-------
 
ttcgaaaagtcaaaatcccttttgattttccctcgttttttcatgtaaggtttggtgtttgattttgatggatttagcggtggtagaggaggaggatatg  18693700
<- Previous    Next ->

AGI:  At2g45320.1   
Description:  binding / catalytic. similar to unnamed protein product [Vitis vinifera] (GB:CAO24538.1); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 18691190    to: 18693219    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g45330.1   
Description:  EMB1067 (EMBRYO DEFECTIVE 1067); tRNA 2'-phosphotransferase. similar to tRNA 2'phosphotransferase, putative [Arabidopsis thaliana] (TAIR:AT5G23600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24541.1); contains InterPro domain Phosphotransferase KptA/Tpt1; (InterPro:IPR002745)
Range:  from: 18693410    to: 18695109    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version