AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    <----------ID1
   --------->DEAR3(2)
-------->AHL20(2)                                                                              -----
--------->DOF2                                                                               <------
--->LBD16                                                                            --------->At4g35610
-->ANAC46                                --------->At4g35610                         --------->ZAT2
-->ANAC58              --------->KAN1   --------->RVE1(2)                    <---------At4g35610
-->ANAC58--------->ANAC58     ---------->DOF2      --------->TOE2(3)         --------->At4g35610   <
--LBD16  --------->ANAC58   --------->LBD16    --------->AHL12(1)         ---------->DOF2  <--------
 
aataaaaccgacaagcttagaagcacttgtccgaaaaacagagtagctaaaatttcttaaaactctagtggagaactcaaagctcacgagcttcctttgt  18517000
                                                       <-----------GT1
                                                    --------->ARR14(2)
                                                    <---------ARR14(2)
                                               --------->LBD16
                                           --------->RVE1(2)
                                           --------->GATA12
                                           --------->ARR14(3)
                                           --------->ARR11(3)
                                           <---------ARR14(3)
                                           <---------ARR11(3)
                                           --------->ARR14(2)
                                      --------->LBD16 <-------TEIL
                                     <---------HSFB2a(2)
                                     --------->HSFB2a(2)
                                     <-----------RAV1(2)<---------At5g28300
                               <---------TOE1(2)    <---------GLK1(2)
                            ------>ZmHOX2a(2) --------->ANAC58
                           <------ZmHOX2a(2)  --------->ANAC46
                          <---------GATA12 <---------ARR11(2)
                          <---------ARR11(2)  --------->ANAC58
                          --------->RVE1(2)--------->ARR11(2)
                          <---------ARR11(3) ------>ZmHOX2a(2)
                          --------->ARR11(3) ===================================HOX2a_HOX2a
                          --------->ARR14(2) <---------LBD16
                          <---------ARR14(2)--------->ARR14(1)
                          --------->GATA12 <---------ARR14(2)            ------>ZmHOX2a(1)
                          --------->ARR11(2)--------->CCA1(2)            <----------DOF2
                         <---------HSFB2a(1)====================================HOX2a_HOX2a
                         --------->HSFC1(2)--------->ARR11(1)    ------>MYB46(1)
                         --------->KAN1    <---------GATA12      ------>MYB83
                         <---------KAN1   <---------GLK1(1)<---------ZAT14
----->ID1                --------->HSFB2a(1)<------ZmHOX2a(2)   --------->MYB52(1)
-----RAV1(1)            ----------->ARR10----------->ARR10 --------->ZAT14   <---------YAB1      <--
-----------GT1          ---------->TaMYB80<---------HSFB2a(1) --------->DEAR3(2)         <---------GLK1(2)
--DOF2             ------->GAMYB <-----------HVH21  --------->GATA12    <---------DOF5.7(1)      <--
 
tgtttccatttctctccatcaacagcgaagatcccatgtcccagaagatccgcaagattcactgtaccaacgggtcctttactatagttatggaatcttg  18517100
                          ================================HOX2a_HOX2a
                          ------>ZmHOX2a(2)
                         --------->GLK1(1)
                         =================================HOX2a_HOX2a
                         --------->At4g35610
                        --------->ARR11(2)
                        <---------ARR11(2)
                        <---------ARR14(2)
                        <---------ARR14(3)
                        <-----------ARR10
                        --------->ARR14(3)
                        --------->GLK1(2)
                        --------->ARR11(3)
                        --------->ARR14(2)
                        <---------ARR11(3)
                        <---------RVE1(2)
                        <---------GATA12
                    --------->LBD16  <---------ARR11(3)
                    <---------LBD16  --------->ARR11(3)
               <-------MYC3          <---------ARR14(2)
               <-------MYC2          <-----------ARR10
               ------->MYC2    --------->At5g28300
            <---------ALFIN1<---------ZAT14
         --------->ANAC46<------ZmHOX2a(2)                                                        <-
      --------->KAN4(2) <---------AGP1                                                    ------>ZmHOX2a(2)
     --------->KAN1<---------TOE1(1) --------->RVE1(2)                                   <------ZmHOX2a(2)
     <---------KAN1<---------ANAC46 <---------KAN1                                      <---------GATA12
    <---------ARR14(2)  --------->RVE1(2)                     --------->GLK1(2)         <---------ARR11(3)
    <---------KAN4(2)   --------->GATA12                      ------->TEIL              --------->GATA12
    --------->GLK1(2)<---------TOE1(2)                       <---------ARR14(2)     --------->ANAC46
    --------->ARR14(2) <------ZmHOX2a(1)                     --------->ARR14(2)    ------>ZmHOX2a(1)
    ---------->TaMYB80----------->ARR10            ------>ZmHOX2a(1)        <----------DOF2       --
-------ANAC58  ------->MYC3 --------->ZAT14      <---------ANAC46  ---------->DOF2 =============HOX2a_HOX2a
-------ANAC58 --------->ANAC46----------->GT1  <-----------HVH21--------->TOE1(3)  ==============HOX2a_HOX2a
 
tcttgagaatatgctccacgttccgaggatctgcagtgaatatctcgctctgtcctggactcaagaacctgaaagtaggctttgtcctcgcgatctctgt  18517200
                                                                                              ------
                                                                                <---------GLK1(1)
                                                 <---------ZAT14               <---------ARR14(2)
                                              <---------bZIP60(2)              --------->ARR14(2)
                                              <---------ANAC58              <---------HSFB2a(2)
                                              <---------ANAC55(1)           --------->HSFB2a(2)
                                              <---------ANAC58             <---------LBD16   -------
                                 =============================HOX2a_HOX2a--------->ARR14(2)  <------
                                 <------ZmHOX2a(2)                       <---------ARR14(2)  -------
                                <---------ARR11(3)         <---------ARR14(2)  <---------RVE1(2)
                                --------->ARR11(3)         <---------ARR11(2)  <---------GLK1(2)
               <---------RAP2.6(2)            <---------ANAC46        <---------ANAC58       <------
             <-----------RAV1(1)--------->RVE1(2)--------->ZAT14      <---------ANAC58--------->LBD16
        --------->AHL25(3)    --------->DOF5.7(1)--------->REM1(2)   ---------->ID1 <---------LBD16
   <---------YAB5           ---------->DOF2  <-----------------------TaNAC69(2)--------->GATA12  <--
--------ANAC55(2)       <---------------------WRI1     <------ZmHOX2a(1) --------->ARR11(2) --------
------->ANAC55(2)    --------->ALFIN1  <---------GLK1(2)  <---------KAN1 <---------ARR11(2)---------
 
ctcgtaatcgtataatttgtggctgtggaagaaaagatcaaagattgtggcgtgtacaggagtatacctcttgtcgtttctggattttccggtgaagatt  18517300
                                     ------>ZmHOX2a(2)
                                    <------ZmHOX2a(2)
                                   <---------ARR14(2)
     --------->MYB59               --------->ARR11(3)                               <-----------GT1
--->GLK1(2)                        --------->ARR14(2)                             *TSS <---------DOF5.7(1)
-->ARR14(2)        --------->DOF5.7(1)<-------GAMYB --------->YAB1     --------->GATA12<----------DOF2
---GLK1(2)       ---------->DOF2   <---------ARR11(3)                  --------->RVE1(2)<---------DOF5.7(1)
-->ARR11(3)   <---------------------WRI1   <-----------GT1             <---------ARR11(3)
---ARR14(2)   --------->ZAT18      --------->GATA12<---------YAB1      --------->ARR11(3)
-------YAB1<---------ANAC58 ================HOX2a_HOX2a     --------->KAN1      --------->YAB5
->KAN1 <---------RVE1(2)    ===============HOX2a_HOX2a      --------->AtLEC2   <---------ATHB12
-->ARR10   <---------ANAC58 <------ZmHOX2a(1)    --------->YAB1       <---------GLK1(2)<---------DAG2
 
ctgatagttagatagagtgcgaaagacagaaggatgaagatcgttgttactactataatcgccatgctcgtcaaaatctccattgattcacttttttttt  18517400
                                                                                    --------->DAG2
                                                                                <---------ANAC55(2)
                                                                                --------->ANAC46
                                                                                --------->ANAC58
                                                                                --------->ANAC58
                                                                              --------->YAB5
                                             --------->ANAC46                 --------->YAB1
               <---------ANAC58              --------->LBD16                 <---------ATHB12    <--
               <---------ANAC58    ------------>CBF                        --------->YAB1       <---
               <---------ANAC46   <-----------GT1                          --------->WOX13(1)   <---
 <---------ANAC46              --------->AHL12(1)                         --------->MYB46(3)    <---
 <---------ANAC58              <---------AHL12(1)         <-----------TBP------------>CBF       ----
 <---------ANAC58            <---------RVE1(2)--------->LBD16      --------->YAB5  ---------->DOF2
 
tttggcttggaagttgtttcgtcttgttgtctgattttttcaatcttcccgctaagaagtcatatatagacgattcaacaatcacgaaaagtcaagacgg  18517500
             --------->ANAC58
         --------->MYB46(3)                                     <------------MYB.PH3(1)
       ------->TEIL                                        <---------ZAT6
    --------->ANAC46                                     <---------ANAC58
    --------->ANAC58                                     <---------ANAC46
    --------->ANAC55(1)                            <---------TOE2(3)
    --------->ANAC55(2)   ------->TEIL             <---------TOE1(3)
    --------->ANAC58--------->GLK1(2)           --------->DOF5.7(2)<---------GLK1(2)
<-----------GT1   --------->KAN1             <---------TOE1(3)<---------ARR14(2)
-------KAN1--------->MYB52(1)                <---------TOE1(2)<---------ARR11(2)
------RVE1(2)--------->ANAC58                <---------TOE2(3)--------->ARR11(2)
------ARR14(2)   <---------YAB5              <---------TOE2(2)<-----------GT1    <---------TOE2(3)
------GATA12 --------->ANAC46     <----------DOF2 <---------DOF5.7(2)<---------KAN1              <--
----->ARR14(2)------->GAMYB      <---------DOF5.7(1)     <---------ANAC58---------->ID1          ---
 
attttacacgcatccaacgaaacattctgaaccctctcttttacctcgaaggttaacgttgagtgtaaccgattttgtcgttttgatgttttctcatgta  18517600
                                                                       <---------AHL20(2)
                                                                   <---------AHL25(1)
                                                                   <---------AHL25(3)
                                                                   --------->AHL20(2)
                                                                   <---------AHL20(2)
                                                                   --------->AHL12(3)          -----
                                                                   --------->AHL25(1)         ------
                                                                   <---------AHL12(3)       <-------
                                                                   --------->AHL12(1)      ---------
                                                        --------->ANAC55(1)              --------->CCA1(2)
                                                        --------->ANAC55(2)             <---------RVE1(2)
                                                        --------->bZIP60(2)             --------->ARR11(3)
            --------->DOF5.7(1)                         --------->ANAC46                --------->ARR14(2)
     ----------->GT1                                    <---------ANAC55(2)             <---------ARR14(2)
    <---------MYB46(3)                                  --------->ANAC58  <----------ID1<---------ARR11(2)
   <---------ANAC46                                     --------->ANAC58---------->DOF2 <---------ARR11(3)
 <-----------RAV1(1)                          <----------DOF2 --------->YAB1            --------->ARR11(1)
-------YAB5 --------->DAG2                <----------DOF2    <---------YAB5     --------->MYB52(1)
------>ICU4---------->DOF2           <------NtERF2 <-----------GT1 <---------AHL12(1) ----------->ARR10
 
gtaattgtgggtgaaaaagtcgcacaatatgaattagggcctcaactttcttttgtaccacgtaatcaaattatataaagacaaaacagaagatatgggg  18517700
                                             ----------->GT1
                                   <---------AHL12(3)
                                   --------->AHL12(3)
                                   <---------AHL20(2)
                                   --------->AHL20(3)
                                   <---------AHL25(2)
                                <---------ARR11(3)
                       <---------YAB1     <---------RVE1(2)
                    <---------YAB1 --------->AHL25(3)
                  --------->YAB5--------->AHL20(1)
                 <---------AHL20(2)<---------AHL25(1)                                           <---
                <---------WOX13(1) <---------AHL20(3)                                          -----
------>GT1     --------->WOX13(2) <---------AHL12(2)                                  --------->ANAC58
----->GT1      <---------WOX13(2) --------->AHL12(2)                        ------>ZmHOX2a(1)  -----
--LBD16      <---------YAB1     --------->AHL20(2)   --------->DAG2      ---------->ID1      <------
>ALFIN1      <---------AHL20(2)<---------CCA1(2)    ---------->DOF2--------->ALFIN1   --------->ANAC58
 
gaaaaatgtgttttttttaattgattatacttccatatattatttgatatgaaaaaaaagttttttagaggtgtttgtcctccttggacacgaagagtaa  18517800
                                                                                      <---------ICU4
                                                                            --------->KAN1
                                                                           <---------MYB52(1)
                                                                          <---------RAP2.6(3)
                                                                         <---------ATERF1(2)
                                                                         --------->ATERF1(2)
                                             ---------->DOF2            <---------ANAC46      ------
------YAB5                         --------->ICU4                 --------->ATHB12  <---------ARR11(3)
---->ANAC58                   --------->ANAC46            <---------ANAC55(2)       --------->ARR11(3)
---->ANAC58  <-------TEIL   --------->At4g35610         <---------KAN1  <---------LBD16       ------
---KAN1  >>>>>>>>>MYB98     <---------At4g35610   ----------->GT1<---------YAB5 --------->ANAC46   -
 
gcattctctagtaacatacagtagtcttctcatcagccattttgaagcgaaagaagtgaataagtgtcttcatttgccggtatgcgaaatctttgccaag  18517900
<- Previous    Next ->

AGI:  At2g44890.1   
Description:  CYP704A1 (cytochrome P450, family 704, subfamily A, polypeptide 1); oxygen binding. similar to CYP704A2 (cytochrome P450, family 704, subfamily A, polypeptide 2), oxygen binding [Arabidopsis thaliana] (TAIR:AT2G45510.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24404.1); contains InterPro domain Cytochrome P450, E-class, group I; (InterPro:IPR002401); contains InterPro domain Cytochrome P450; (InterPro:IPR001128)
Range:  from: 18515467    to: 18517383    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version