AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    --------->GLK1(1)
   --------->GATA12                   <---------ALFIN1
--->YAB1                             <---------ZAT18
----ICU4                             --------->ZAT18              <---------ANAC58
-->HAHB4                           --------->PCF2                 <---------ANAC58
---ATHB12           <-----------GT1<---------ZAT18     --------->KAN1
-->ICU4          --------->AHL20(3)--------->ZAT18   ------>ZmHOX2a(1)
---YAB5        <---------KAN1   <------MYB46(1)   ------>ZmHOX2a(1)      <----------DOF2
---YAB1   --------->ANAC46      <------MYB83 ---------->ID1    <----------DOF2                 <----
--TOE2(3) <---------TOE2(3)   <--------P <----------DOF2      <---------DOF5.7(1)         --------->YAB1
 
tggtgagatttctaaggcatatttttctctcttgtaggtgcccactttgtctcctccttcattctcctttcgttttcttttcttagtttgttttcatact  18458100
                                                   --------->WRKY38(1)
                                              ------->TEIL
                                            <---------SPL7(1)
                                           --------->ANAC55(2)
                                           <---------ANAC55(2)
                                           --------->ANAC58
                                           ==============MYC_MYB
                                       <-----------HVH21
                      --------->At4g35610  --------->ANAC58          ------>MYB46(1)
                      <---------At4g35610  <---------TGA1a           ------>MYB83        <---------ARR11(2)
                  --------->ALFIN1 <---------ZAT2 <---------MYB52(1) --------->MYB52(1)  --------->RVE1(2)
             <-------TEIL<-------TEIL --------->ANAC58       --------->TOE2(3)           --------->ARR11(2)
    =================================================bZIP_DOF--------->TOE1(3)        <---------AHL25(1)
    <----------DOF2  <---------RVE1(2)--------->ANAC58       <---------MYB59          --------->AHL12(3)
------DOF2 --------->AHL12(2)      --------->ZAT2<-------GAMYB     <---------MYB59    <---------AHL12(3)
 
ttgatgtctttgaaaattcatgtggagatgcatacacgagctcgtcacgtaccgttggctataacctaaacctaactacatagttctatatatatccact  18458200
                                                                                   <---------ANAC55(2)
                                                                           ----------->GT1
                                                                          <-------TEIL
                                                                       <---------ANAC58
                                                                       <------MYB83--------->ANAC46
                                                                       <---------ANAC58
                                                                       <------MYB46(1)       -------
                                                                      ----------------------->TaNAC69(2)
                                                                      --------->MYB59       <-------
                                                            --------->AHL25(2)     --------->ANAC58
                        --------->ATHB12    <---------KAN1  <---------AHL12(2)     --------->ANAC55(2)
                       <---------YAB1     <------ZmHOX2a(1) --------->AHL12(3)     --------->ANAC55(1)
               <---------ARR11(3)       <---------TOE2(3)   --------->AHL20(2)     --------->ANAC58
               --------->RVE1(2)        <---------TOE1(3)   <---------AHL12(3)    <-------TEIL
 
attttcatacaagttcaatatcaattttcattgaaatgagtttgaggataaaacaagaacaaaaaatataagttgggttcgtaaatacgtaagttatcaa  18458300
                                                                                                   -
                                                                                                   -
                                             <---------At4g35610                                  <-
                                        --------->RVE1(2)                                        <--
 --------->AHL25(2)                     <---------ARR11(2)                                       <--
 --------->AHL20(1)                     --------->ARR11(2)                                     <----
 <---------AHL25(2)                    <---------CCA1(2)                                 --------->CCA1(2)
 --------->AHL12(1)                 ------>ZmHOX2a(2)                                    <------ZmHOX2a(2)
 <---------AHL25(3)               <---------GATA12                                      <---------ARR11(2)
 <---------AHL12(1)               <---------ARR11(3)                                    --------->ARR11(2)
 <---------AHL25(1)               --------->ARR11(3)                                    --------->RVE1(2)
 <---------AHL20(2)               <---------ARR11(2)                                    <---------ARR14(2)
 --------->AHL20(2)               <---------AGP1                                        --------->AGP1
<---------AHL12(3)                --------->ARR14(2)                                    <---------GATA12
--------->AHL12(3)       --------------->AGL15                                          --------->GATA12
--------->AHL25(1)       <---------------AGL15                                          --------->ARR11(3)
<---------AHL25(1)      <-----------------AGL2                                          <---------ARR11(3)
--------->AHL25(2)      =======================================================================MADS_MADS
<---------AHL25(2)      <-----------------AGL3                  <---------KAN1 <---------------AGL15
--------->AHL25(3) <---------ICU4 --------->ARR11(2)      --------->DAG2      ----------------->AGL3
--------->AHL20(2) --------->YAB5 <---------ARR14(2)      --------->DOF5.7(1) ======================
-->YAB1          --------->RVE1(2)--------->GATA12       ---------->DOF2   --------->GLK1(1)  ------
--YAB1    --------->RVE1(2)      <---------CCA1(2) ---------->DOF2   <-----------GT1    --------->ARR14(2)
 
aaaaaaaattgaaactctaaaatcaatactatttgtggatctatatccagcaaacaaaggaaaaggaatgtattactgaattccaaaataagatccagtg  18458400
                                                                  <---------TOE2(3)
                                                                 ---------->DOF2
         --------->ANAC58                                     --------->WOX13(2)
         --------->ANAC58                                     <---------WOX13(2)
 <---------MYB52(2)                                          ------>MYB46(1)
<------NtERF2                                                ------>MYB83
---------->RAV1(1)                                         --------------->AGL15
----->NtERF2       <---------YAB1                          <---------MYB59                         -
---------ID1     ----------->GT1                           <---------------AGL15                  <-
-------------------WRI1                                   ----------------->AGL3                 <--
-------PCF2      --------->YAB1                         --------->CCA1(2)    --------->MYB52(2) ----
-----MYB46(3)  <------------CBF           ---------->DOF2 ----------------->AGL1                ----
============================================================================MADS_MADS          <----
--->ALFIN1  ------------>CBF ------------>CBF          <---------ARR11(3)    --------->MYB59  <-----
 
ggcgacaaacccaagcccaattgtaattcaggcccaatgggcctacaaagcagaacaagataccaaattaaggcacaagttagttcgaaaaactttctcc  18458500
                <------NtERF2
               <---------ATERF1(1)
               <---------ORA47(2)
               <---------RAP2.3(1)
               ----------->RAV1(1)
               ------>NtERF2
               <---------DEAR3(2)
               --------->RAP2.6(2)
              <---------RAP2.3(2)
              <---------DEAR3(1)
              <---------RAP2.3(3)
             --------->RAP2.3(1)
            <---------ORA47(2)
            ------>NtERF2
            --------->LBD16
            <---------RAP2.3(1)
            <---------RAP2.6(1)
            <---------DEAR4(2)
            <---------ATERF1(1)
           <---------RAP2.3(2)
           --------->ATERF1(2)
           <---------ATERF1(2)
           --------->DEAR3(1)
          <---------LBD16
 <---------ARR11(2)
 --------->ARR11(2)
 --------->ARR14(2)
 <---------ARR14(2)
*TSS    --------->ANAC46<----------DOF2                 <---------AHL20(3)
<------NtERF2--------->ATERF1(1)                       <---------KAN1
-------->LBD16--------->ATERF1(2)            <---------WOX13(1)
--------ANAC46<---------ATERF1(2)          --------->ATHB12
-------LBD16<---------ERF1                 --------->YAB5<---------AHL20(2)
-->NtERF2 --------->ATERF1(1)             <---------YAB1--------->AHL20(2)
----->LBD16<---------DEAR3(1)  <---------ANAC58 <---------ANAC58
-----DEAR3(1)<------NtERF2     <---------ANAC46 <---------ANAC46                     <-----------HVH21
----LBD16<---------RAP2.3(1)   <---------ANAC58 <---------ANAC58          <---------GLK1(1)     ----
 
ggcggaaacttacgccggcggcacaaactttgtgtcttgctcaagatgattgcgtcgaattttatgtaaacaattggctctccgatgttgtcagccatgg  18458600
                                                         --------->ANAC58
                                                         --------->ANAC58
                                                        <-------TEIL
                                                       --------->CCA1(2)
                                                       --------->KAN1
                                                       --------->ARR14(1)
                                                      --------->ARR14(2)
                                                      <---------ARR14(2)                     -------
       <-----------GT1                                <---------ARR11(2)                     <------
   --------->YAB5                                     --------->ARR11(1)                 --------->YAB5
  <---------YAB5                                      --------->ARR11(2)            <---------At5g28300
  <---------YAB1                    --------->ANAC58  <---------RVE1(2)            <-----------GT1
  --------->ICU4          ------>ZmHOX2a(1)    <---------SPL7(1)                 <---------KAN1-----
--->TEIL           <----------DOF2  --------->ANAC58----------->ARR10          <---------GLK1(2)   -
 
atgttatgattcactcttcaagctttctcctcccttgcgacgaaacttgtgggacgagatacgctctcgttgttcttaaccagaatttaccacgattcac  18458700
                                                                                   --------->ZAT14
                                                                             --------->GLK1(2)
                                                                            <---------ARR14(2)
                                                                            --------->KAN4(2)
                                                                           --------->KAN4(1)
                                                                           --------->HSFB2a(1)
                                                                           <---------KAN4(1)
                                                    ------->TEIL           --------->KAN1
                                                    --------->GLK1(2)      <---------KAN1
                      <-----------GT1             --------->YAB5           <----------TaMYB80
                     <---------ICU4          <---------AHL12(3)           <---------ARR14(2)
                    <---------YAB5           <---------AHL25(1)           --------->ARR14(2)
                   --------->WOX13(2)        <---------AHL20(3)           ---------->TaMYB80
     <---------LBD16--------->ICU4           <---------AHL20(2)           <---------KAN4(2)
<---------DOF5.7(1)<---------AHL12(2)        --------->AHL20(2)        <---------YAB1
-->KAN1            <---------WOX13(2)     --------->AHL20(1)     <---------AHL20(2)<---------ZAT14
-----GT1           --------->AHL12(2)     <---------ARR11(3)     <---------YAB1    --------->REM1(2)
---->ANAC46    ----------->GT1            --------->RVE1(2) --------->AHL12(2)  <---------ANAC46
----->ZmHOX2a(1)--------->At5g28300      <---------KAN1  <---------MYB52(1)<---------HSFB2a(1)
 
tcctcttctctgggaacatggtaattatctctctattcttcagaatatataaatgaatctgttttttttttattacgaatattctgtgtagaacagcaaa  18458800
                   <------NtERF2
                   --------->RAP2.3(1)
                  <---------RAP2.3(1)                                        --------->KAN1
                 <---------DEAR3(1)                                         <---------YAB5
                 <---------RAP2.3(2)       <-----------GT1             <---------DOF5.7(1)
                 <---------RAP2.3(3)      <---------KAN1               <----------DOF2
         --------->At4g35610       --------->ANAC46                   <---------DAG2
         <---------At4g35610   <---------KAN1                         <---------DOF5.7(1)
       --------->ZAT14        --------->GATA12                     --------->ARR11(3)           <---
       <---------ZAT14        <---------GATA12                     <---------ARR11(3)           ----
 
acttcgtctctgtgctgatggaggcgctaatcgcatctacgacgaattacctctcttcttccctcacgaagacccttttgtcattcgaaacaggtctcag  18458900
                                                                         <---------AHL20(2)
                                                                    --------->AHL25(3)            <-
                                      >>>>>>>>>TBF1              <----------DOF2               <----
                                  <------ZmHOX2a(1)             <---------DOF5.7(1)         --------
------GATA12                   <---------LBD16                 ---------->ID1  <---------RVE1(2)  <-
----->GATA12                   <-----------RAV1(2)    ---------->DOF2<---------AHL20(2)     <-------
 
atttatgtctctatttctctcatagagaaaggtttcaggaagaagaagttgaaactggaaagttttgtctttttattttatagatagttctgagaattgt  18459000
<- Previous    Next ->

AGI:  At2g44750.1   
Description:  TPK2 (THIAMIN PYROPHOSPHOKINASE 2); thiamin diphosphokinase. similar to TPK1 (THIAMIN PYROPHOSPHOKINASE1), thiamin diphosphokinase [Arabidopsis thaliana] (TAIR:AT1G02880.3); similar to unnamed protein product [Vitis vinifera] (GB:CAO39990.1); contains InterPro domain Thiamin pyrophosphokinase; (InterPro:IPR006282); contains InterPro domain Thiamin pyrophosphokinase, vitamin B1-binding region; (InterPro:IPR007373); contains InterPro domain Thiamin pyrophosphokinase, catalytic region; (InterPro:IPR007371); contains InterPro domain Thiamin pyrophosphokinase, eukaryotic (InterPro:IPR016966)
Range:  from: 18458501    to: 18459950    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version