AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                ----
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                    <---------AHL12(2)
                                                                                    <---------YAB1
                                                                                   --------->AHL12(2)
                                                                                   <---------AHL12(2)
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL25(3)
                                                                                  <---------AHL25(1)
                                                                                  --------->AHL25(1)
                 <---------GATA12                                                 <---------AHL12(1)
                 --------->ARR11(3)                                               <---------AHL20(2)
          <---------AHL20(2)                                                      --------->AHL12(1)
          --------->AHL20(3)                                                      <---------AHL12(3)
          <---------AHL12(3)                                                      --------->ATHB51
---------RVE1(2) <---------GLK1(2)                                               --------->AHL12(1)
------->ATHB12   <---------ARR11(3)                                              <---------YAB5-----
---YAB1 <---------KAN1     <---------GLK1(2)                                     <---------AHL12(1)
---AHL20(2)      <---------RVE1(2)                                        <-----------RAV1(1)<------
->AHL12(3)--------->AHL25(1)                                            ------>ZmHOX2a(1)    <------
->AHL20(3)--------->AHL20(2)                                          <---------ZAT14        <------
--AHL25(2)--------->AHL12(3)                               <---------ANAC58<-------GAMYB  ----------
--AHL20(3)--------->AHL25(3)                 --------->YAB1<---------ANAC58=========================
--AHL12(3)<---------AHL25(3)                <---------YAB1 --------->ANAC55(2)   --------->AHL25(3)
--AHL20(2)<---------AHL25(1) <---------MYB46(3)           ------->TEIL--------->ZAT14    <----------
 
ttgataggcgaatttaaatagattttggcagattgttgcaagttgctatcatcgggctctgtacgtgttccagtcctctgttgaattatttatgtcacgt  18156000
    ------->TEIL                                             --------->ATHB51
<---------GATA12                                             <---------AHL25(3)
--------->GATA12                                             -------->ATHB1
----->REM1(2)                                                --------->ATHB12
--MYC3                                                      <---------AHL20(3)
->MYC2                                                      <---------AHL25(1)
--MYC2                                                      <---------AHL20(2)
->MYC3                                                      <---------ATHB51
---ANAC58                                                   --------->AHL20(2)
-->TGA1a                                                    --------->ICU4
---O2  --------->ATHB12                                     --------->AHL25(2)
---ANAC58                                                   --------->AHL25(3)
-->ANAC55(2)                                                --------->AHL12(1)
-->O2 --------->ICU4                                        <---------AHL12(1)
---TGA1a                                                    <---------AHL25(2)
---ANAC55(1)                                               --------->AHL12(2)
---->ALFIN1                                               --------->AHL12(2)
---ANAC55(2)                                             --------->AHL20(2)
---ANAC46           --------->TOE1(3)                ----------->GT1--------->ANAC58
---bZIP60(2)  ------>ZmHOX2a(2)                     --------->DAG2  --------->ANAC46          ------
->HVH21<---------AHL20(2)                          ---------->DOF2  --------->ANAC58          ------
===MYC_MYB  <---------GATA12                  ----------->GT1<---------ICU4            ----------->GT1
-HVH21<---------YAB5--------->TOE2(3)  ---------->DOF2----------->GT1           <-----------GT1
 
gtagatgtatttattgatctaaacctaaaacgatagaagaactaaagtcttgtgaaaagttaaattattgcaagctatactatttacaaaatgtaaaaaa  18156100
                     <------MYB83
                    --------->MYB59
        --------->KAN1
        <---------AHL25(3)
        <---------AHL12(1)
        --------->AHL12(1)
       --------->AHL25(3)
       --------->AHL25(2)
       <---------AHL25(1)
       --------->AHL12(1)
       <---------AHL20(3)
       --------->AHL20(3)
       --------->ICU4<------MYB46(1)                          <----------DOF2
       <---------ATHB51                                      <---------DOF5.7(1)
       <---------AHL12(1)                          --------->bZIP60(1) <---------ARR11(3)
       <---------AHL25(2)                        <---------TGA2(2) ---------->DOF2     <---------KAN1
       --------->AHL25(1)            <---------ARR11(2)    --------->ARR11(3)         ------->TEIL
---->DOF2 <---------YAB1            --------->GLK1(1)      <---------ARR11(3)    --------->MYB52(1)
--->DOF5.7(1)<----------DOF2        <---------KAN1 <---------bZIP60(1) --------->ARR11(3)         <-
 
agaaactgaaattattcttttgtttggttcacattaggcatttccaaattgctgatgtcaaacatctttgcaaagttcttctcccaacgaattttgaaaa  18156200
                 --------->AHL25(2)
                 --------->AHL20(3)
                 <---------AHL20(3)
                 --------->AHL12(1)
                 <---------AHL12(1)
                 <---------AHL25(2)
              <---------AHL20(2)
              --------->AHL20(2)
              <---------AHL20(3)                              --------->TOE2(3)
              <---------AHL12(3)                           <-----------GT1
              --------->AHL25(1)                         --------->AHL20(2)
              <---------AHL25(1)                         <---------AHL20(2)
              <---------AHL25(2)                         <---------AHL25(1)
          --------->YAB5                               <---------WOX13(2)
         <---------YAB1  --------->WOX13(2)            --------->WOX13(2)                          <
       <-----------GT1 <---------YAB1                 <---------ICU4--------->AHL20(2) <------------CBF
----------GT1 --------->AHL20(3)  ---------->DOF2    --------->ICU4 --------->YAB1 <---------LBD16 -
 
ttcaccattttcacgattaaaattttaaaattgactaaaaagttttaatctcgcacataattaaaccacaataaaaaaacttggacttcggattgttttc  18156300
                                           --------->AHL20(1)
                                           <---------AHL25(3)
                                           <---------AHL20(1)
                                           <---------AHL12(3)
                                           --------->AHL20(2)
                                           --------->AHL25(2)
                                           <---------AHL25(2)
                                           --------->AHL25(3)
                                           --------->AHL25(1)
                                           <---------AHL20(2)
                                           --------->AHL12(3)
                                          --------->AHL20(3)
                                          --------->AHL12(3)
                                          <---------AHL20(2)
                                          --------->AHL20(2)
                                          <---------AHL12(3)
                                          <---------AHL25(1)
                                          <---------AHL20(3)
                                          --------->AHL25(3)
                                          <---------AHL25(2)           --------->O2
                                         --------->AHL12(2)            <---------TGA1a
                                  --------->WOX13(2)                   <---------O2
              <---------KAN1      <---------WOX13(2)                   --------->ANAC55(2)
       <---------ARR11(2)         <------------CBF                     <---------ANAC55(2)
      --------->YAB5         <---------DOF5.7(1)                    ----------->HVH21             <-
      --------->KAN1        <----------DOF2<---------AHL25(1)      <-----------HVH21            <---
   --------->At4g35610      <---------DOF5.7(1)                   <---------ANAC58              ----
   <---------At4g35610     <---------DOF5.7(1)                    <---------ANAC55(2)        -------
 --------->ZAT18    <---------ANAC58----------->GT1               <---------ANAC58           <------
--------->ALFIN1    <---------ANAC58--------->YAB1  --------->ANAC55(2)=============================
-------MYC3  --------->ARR14(2) <---------YAB1<---------YAB1  --------->KAN1             <---------MYB52(1)
------>MYC3  <---------ARR14(2) <---------AHL20(2)<-----------GT1 --------->ANAC46     *TSS<--------
 
catgtgggctgattcgaatttgggcttgggcctttttaattgtaattttatttttacttatttgtaaatgcgtcacatgtcttcttcgctctgttcggct  18156400
                                       --------->WRKY38(1)
                                       <---------ZAT18
                                       --------->ZAT18
                                    <---------ANAC46
                                    <---------ANAC58
                                    <---------ANAC58
                                --------->MYB52(2)              <---------GLK1(1)
                                --------->KAN1                  --------->GLK1(1)
---------DOF2                   <---------MYB46(3)             --------->GATA12
------At4g35610               <---------MYB52(1)               <---------GATA12
----->At4g35610           <---------At5g28300        <---------MYB52(1)
-->At4g35610             <-----------GT1            <-------GAMYB
---At4g35610           --------->WOX13(2)          <---------MYB46(3)
=========bZIP_DOF      <---------WOX13(2)          --------->MYB52(2)        <---------At4g35610
-RAP2.6(2)            --------->WOX13(1)          <-------TEIL <---------RVE1(2)  --------->ARR11(2)
 
gcttcatcgagcggaagtctctagccaattaccgtttgttcgtggactcgaggttcgttgttcttagatttcccagactcatctgtttctgcaatccatt  18156500
                                            <---------WOX13(1)
                                    --------->GLK1(1)
                                    <---------GLK1(1)
                       --------->ANAC58    <---------WOX13(2)
                       --------->ANAC46  ------>ZmHOX2a(1)                                        <-
                       --------->bZIP60(2) --------->WOX13(2)                                  <----
              --------->ANAC55(2)   <---------KAN1             <----------DOF2                <-----
            <-----------GT1        <----------DOF2  <---------TOE1(3)--------->ZAT18       ---------
         <---------DOF5.7(1)   <---------LBD16      <---------TOE2(3)<---------ZAT18     <---------LBD16
        <----------DOF2--------->ANAC58----------------->AG<---------TOE1(3)          <---------RVE1(2)
       <---------DOF5.7(1)--------->KAN1<---------MYB59    <---------TOE2(3)         --------->KAN1
 
tcaaagtttctctttttacttaatccaagtcattcgcgcatttcctaattggtctgaggtttagggttttagggcacatagttttgtttgattcgggagt  18156600
                                                                             ------>ZmHOX2a(2)
                                                                           --------->ARR14(2)
                                                                           <---------ARR11(2)
                                                                           --------->ARR11(2)
                                                                           <---------ARR14(2)
                                                                           --------->ARR11(3)
                                                                           <---------ARR11(3)
                                                                           ------->TEIL
                                                                           --------->GATA12
                                                                <---------WOX13(1)
                    <---------RVE1(2)                         --------->ATHB12--------->HSFB2a(2)
                   <------MYB46(1)                           <---------YAB1<---------GATA12
     <---------At4g35610                                     <---------AHL20(2)
    <---------RVE1(2)                             <----------DOF2   <---------WOX13(1)
--------YAB5       <------MYB83--------->YAB5  <---------ARR11(3)   <----------DOF2    ----------->HVH21
-----KAN1         --------->MYB59    <---------DOF5.7(1)<---------AHL20(2) <---------RVE1(2)      <-
----KAN4(2)       --------->MYB46(2) <----------DOF2  --------->ANAC55(2)  <---------AGP1      -----
>LBD16   --------->TOE1(2)    <---------YAB1   --------->ARR11(3) --------->ATHB12   --------->At4g35610
 
aatcgttgagatgctacgagtttggtattcaagatgattccttttctcaaggtctttatgtaatttgattgatttatggatctcgaattgctgacatgaa  18156700
                            --------->KAN4(2)
                           <----------TaMYB80
                           --------->HSFB2a(1)
                           --------->KAN4(1)
                           <---------HSFB2a(1)
                           <---------KAN4(1)
                           --------->GLK1(1)                      <---------MYB46(3)
                           <---------GLK1(1)                   <------MYB83
                           --------->KAN1                  --------->WOX13(2)
                           <---------KAN1                  <---------WOX13(2)
                          <---------ARR11(3)            <---------MYB59 --------->ARR14(2)
           --------->MYB111(2)                          ------>ZmHOX2a(2)
      ---------->DOF2     <---------RVE1(2)           --------->GATA12  --------->ARR11(3)
    <----------DOF2       <---------ARR14(2)          <---------AGP1    <---------RVE1(2)
   <---------ANAC58       --------->ARR14(2)          <---------ARR11(2)<---------ARR14(2)
   <---------ANAC46       ---------->TaMYB80          <---------GATA12----------->ARR10
   <---------ANAC58       --------->ARR11(3)          <---------RVE1(2) <---------ARR11(3)
---------->ID1            <---------KAN4(2)           --------->ARR11(2)<---------ARR11(2)
----------RAV1(1) <----------DOF2               <---------RVE1(2)<---------ANAC46         ----------
-->TEIL    <---------MYB46(3)--------->GLK1(2) --------->ATHB12<------MYB46(1)<---------TOE2(3)    -
 
tttgttgcttaaagttgttggctttgtgggatattctgaggggtcttgtttgatttggatctaatttggtgggcagatattgtggtttcttagcaaagaa  18156800
                            <---------KAN1
                            --------->MYB46(3)          --------->GATA12
                       <---------HSFC1(1)         <---------ANAC58
                       --------->HSFB2a(2)        <---------ANAC58
                       --------->HSFC1(1)         <---------ANAC46           <---------MYB46(3)
   <---------ZAT14     <---------HSFB2a(2)     --------->GLK1(1)--------->LBD16
  --------->ALFIN1  --------->GLK1(2)     --------->At4g35610  <---------ANAC58
<---------ANAC46  --------->HSFC1(2)      <---------At4g35610  <---------ANAC58
>DOF2             <---------HSFC1(2)   <---------At4g35610  <---------ARR11(2)
-------->ATHB12---------->DOF2         ----------->RAV1(2)  --------->ARR11(2)                    <-
 
gatgagtggagttggagagaaagcttctggaacaactaagacacctgctgatttcttgaaatctatccgtggtaaaccagttgttgtcaagctcaactct  18156900
<- Previous    Next ->

AGI:  At2g43800.1   
Description:  formin homology 2 domain-containing protein / FH2 domain-containing protein. Identical to Formin-like protein 2 precursor (FH2) [Arabidopsis Thaliana] (GB:O22824); similar to AFH1 (FORMIN HOMOLOGY 1), actin binding [Arabidopsis thaliana] (TAIR:AT3G25500.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46319.1); contains InterPro domain Actin-binding FH2 and DRF autoregulatory; (InterPro:IPR003104); contains InterPro domain Actin-binding FH2 (InterPro:IPR015425)
Range:  from: 18152798    to: 18155974    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g43810.1   
Description:  small nuclear ribonucleoprotein F, putative / U6 snRNA-associated Sm-like protein, putative / Sm protein F, putative. similar to small nuclear ribonucleoprotein F, putative / U6 snRNA-associated Sm-like protein, putative / Sm protein F, putative [Arabidopsis thaliana] (TAIR:AT3G59810.1); similar to unknown [Populus trichocarpa] (GB:ABK93371.1); similar to unknown [Populus trichocarpa] (GB:ABK93423.1); contains InterPro domain Like-Sm ribonucleoprotein, core; (InterPro:IPR001163); contains InterPro domain Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core; (InterPro:IPR006649); contains InterPro domain Like-Sm ribonucleoprotein-relat
Range:  from: 18156388    to: 18158372    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version