AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                         <---------AHL20(2)
                                       <---------AHL20(2)
                                       <---------AHL12(3)
                                       --------->AHL12(2)
                                       --------->AHL12(3)
                                       <---------AHL25(2)
                                      --------->AHL12(2)
                                      <---------AHL12(2)
                                     --------->AHL12(1)
                                     --------->AHL12(2)
                                     <---------AHL12(1)
                                     <---------AHL12(2)
                                     <---------AHL20(2)
                                     <---------AHL12(3)
                                     --------->AHL12(3)
                                    <---------AHL12(1)
                                    <---------AHL20(2)
                                    --------->AHL20(3)
                                    --------->AHL20(2)
                                    <---------AHL20(1)
                                    --------->AHL12(1)
                                    <---------ARR11(3)
                                    --------->ARR11(3)
                                    --------->AHL20(1)
                                    <---------AHL25(2)                      <---------ARR11(3)
                                    --------->AHL25(3)                      --------->RVE1(2)      <
                                    <---------AHL20(3)                      --------->ARR11(3)     -
                                    --------->AHL25(2)          <-----------HVH21                  <
                                    <---------AHL25(1)       <---------ANAC58                      -
                  --------->ATHB12  --------->AHL25(1)       <---------ANAC58              <--------
                 <-------TEIL       <---------AHL25(3)  <---------------AtSPL8          <---------MYB52(1)
         --------->YAB5            <---------KAN1      <---------ARR11(3)  <---------CCA1(2)       -
        --------->ICU4     ---------->DOF2        --------->AHL20(2)     ------>ZmHOX2a(1) ---------
 ----------->GT1 <---------YAB1   --------->GLK1(2)---------->DOF2<-----------GT1  -------->P      <
 
agagttgtgaaatgtttagtttcattgcatcaaagagaatatattttttcaaataaaagatagtacttgtcacttcctatatctcttacctgttaactag  17909200
                                                                              <---------YAB1
                                                                           --------->GLK1(2)
                                                                         --------->KAN1
                                                                        <---------YAB1
                                                                        <---------AHL12(2)
                                                                       <---------AHL25(2)
                                                                       <---------AHL25(3)
                                                                       <---------AHL12(2)
                                                                       --------->AHL12(2)
                                                                       --------->AHL25(2)
                                                                       --------->AHL12(3)
                                                                       <---------AHL12(3)
   --------->AHL20(2)                                                 --------->AHL20(2)
  <---------AHL12(2)                                                  --------->AHL25(1)
 <---------AHL12(2)                                                   <---------AHL25(1)
<---------AHL25(3)                                                    <---------AHL20(2)
--------->AHL20(2)                                                   <---------AHL20(3)
---------AHL12(3)                                                    --------->AHL25(1)
-------->AHL25(1) --------->AHL25(2)                                 --------->AHL25(3)
---------AHL20(2) <---------AHL25(2)                                 --------->AHL20(2)           --
-------->AHL20(2) <---------AHL25(1)                   <------MYB83  --------->AHL20(3)           --
-WOX13(2) <---------GATA12                             <------MYB46(1)--------->AHL25(3)         <--
-------->AHL25(3) <---------AHL12(3)                   ----------->GT1<---------AHL25(3)       <----
>WOX13(2) --------->RVE1(2)  ------>ZmHOX2a(1)     <---------ZAT2   --------->WOX13(2)         -----
---------AHL25(1) --------->AHL20(2)               --------->ZAT2   <---------WOX13(2)       <------
 
aaataaataaacaaatccaaaaaaaatgtgtcctacttacttactaatgcttcaagcttggtaacacatcaaattaatattctgatatatcatatatcac  17909300
                       <------ZmHOX2a(1)
               <---------AHL12(2)
               --------->AHL12(2)
               --------->WOX13(2)
              <---------AHL20(2)
              --------->AHL25(1)                                      <---------RVE1(2)
             --------->AHL25(3)                                  --------->ATHB12
     ---------->DOF2<---------LBD16                             <---------YAB1
---->MYB46(1)--------->AHL20(2)                                 <---------YAB5
---->MYB83   <---------AHL20(2)                                 --------->DOF5.7(1)
-------CCA1(2)--------->AHL25(2)                                --------->ICU4                   <--
-----ANAC55(2)<---------AHL25(2)                     <---------YAB1<---------WOX13(1)            ---
---->ANAC55(2)--------->AHL12(3)         --------->MYB59      ---------->DOF2     --------->YAB1----
-----GT1     <---------AHL25(1)       <---------RVE1(2)   --------->ANAC46    <-------TEIL ---------
 
ctatcttacaaagtcattaattttcaggatggaagagattagattaggcactgcttattatacgataaagattgatatggatgcatcatatttccgaaat  17909400
                                                               --------->AHL12(2)
                                                               <---------AHL12(2)
                                                               <---------WOX13(2)
                                                              <---------AHL25(3)
                                                             <---------AHL12(3)
                                                             <---------AHL25(3)
                                                             <---------AHL20(2)
                                                             --------->AHL20(2)
                                                             --------->AHL20(1)
                                                             <---------AHL12(1)
                                                             --------->AHL12(3)
                                                             --------->AHL25(1)
                                                             --------->AHL12(1)
                                                             --------->AHL25(3)
                                                             <---------AHL25(2)
                                                             <---------AHL25(1)
                                                             --------->AHL25(2)
                                                            <---------AHL12(3)                ------
                                                            <---------AHL25(2)               <------
              <---------MYB52(1)                            --------->AHL12(2)               -------
            <---------TOE2(3)                               --------->AHL20(2)             ---------
            --------->ANAC46 --------->ANAC58               --------->AHL25(1)          --------->YAB1
-------------AtSPL8  <---------RVE1(2)                 --------->ANAC58         <---------ATHB12 <--
------>DAG2<---------At5g28300            <---------YAB5    --------->AHL25(3)  ----------------->AGL3
------>DOF2<---------LBD16   --------->ANAC46          --------->ANAC58        --------->RVE1(2)----
>LBD16    <-----------GT1    --------->ANAC58<---------MYB52(1)--------->WOX13(2)    --------->YAB1
 
aaagtacaagtatttacggtatgtgattttgctcgaaacttaagagtcgtttcttagtaagaaattaattaacatcgacacaaatcaaaaatagtaacga  17909500
                                                            <--------HAHB4                     <----
     ----------->GT1               <---------At4g35610      --------->ATHB12                  ------
 --------->AHL20(2)                --------->At4g35610      <---------ICU4                   -------
 <---------AHL20(2)             <---------At4g35610         *TSS      --------->YAB1        <-------
 --------->AHL20(3)        --------->TOE2(3)                --------->YAB1                <---------ICU4
 <---------AHL20(3)        --------->TOE1(3)                --------->YAB5               <---------YAB5
->GAMYB <-----------GT1 <---------ARR11(2)                 <---------YAB5              --------->REM1(1)
---MYB52(2)             ------->TEIL  <---------At4g35610  <---------YAB1      --------->YAB1<------
-->MYB46(3)             --------->ARR11(2)                 <---------ATHB12   <---------YAB1<-------
>MYB52(1)         <-------TEIL  --------->At4g35610        --------->ICU4   --------->YAB1--------->YAB1
-------KAN1  ----------->TBP------>ZmHOX2a(1)   --------->MYB46(3)   <-------TEIL   <---------ANAC58
--->TEIL------->TEIL   <---------CCA1(2)     --------->REM1(1)   <---------TOE2(3)  <---------ANAC58
 
acataaaaatgtaactatatatacatgtatccttaagctgctgctactacaacaactcgctaatcattaagtttcataactataatggcttcatcatcat  17909600
                                                             --------->WOX13(2)
                                                             <---------WOX13(2)
                                                            ------>MYB83
     --------->RVE1(2)                                    <---------MYB46(2)
--------->RVE1(2)                                         <---------MYB59
-----YAB1                                                 <---------MYB111(1)        --------->RVE1(2)
--->TOE2(3)                                             ------->TEIL           <-----------HVH21
-->YAB1                                             --------------->AtSPL8  --------->ZAT2
--YAB5                                           <---------DAG2             <---------ZAT2
---ICU4       --------->GLK1(2)           ------>ZmHOX2a(2) ------>MYB46(1) <---------At4g35610
--YAB1 --------->YAB1       <---------TOE2(3)    <----------DOF2            --------->At4g35610
 
caatatcaaatcacaagattccaaacacactaatgtttttggtgatcgtaaactttttgtacctaattcaaactaattcagctgtcagtatcagttccaa  17909700
                                  <---------At4g35610
                  --------->GLK1(2)
                 --------->ARR14(2)                               <---------ANAC46
                 <---------ARR11(3)                               <---------ANAC58
                 <---------GLK1(2)--------->ZAT2                  <---------ANAC58
        --------->O2 <---------HSFB2a(2)               ------>MYB46(1)    ------->GAMYB
      <---------ALFIN1            --------->At4g35610  ------>MYB83      --------->MYB46(3)
   ------->GAMYB <---------ARR14(2)        --------->YAB1        --------->MYB52(2)        ------->TEIL
 
ttccaactcccacttctcaagattctcgagacatcgaagctcaccatcatcaaaaaccaaacaagggtttcttgcaacggtccaagagagtatgaaccat  17909800
                                                                  --------->GATA12
                                                             ------->MYC2
                                                            --------->KAN1
                                                            --------->TGA1a
                                 =====================================bZIP_DOF
                                 <----------DOF2          <---------ALFIN1                        --
                                <---------DOF5.7(1)     <---------ALFIN1                   ---------
                               <---------DAG2    --------->SPL7(1)<---------GATA12      --------->ZAT2
                          --------->TOE2(3)   ----------->GT1<-------MYC2               --------->At4g35610
                       <-----------GT1       --------------->AtSPL3<------ZmHOX2a(2)    <---------ZAT2
                   <----------DOF2           <-----------------------TaNAC69(2)         <---------At4g35610
                  <---------ANAC58         <---------ARR11(2)<-------MYC3          -----------------
                  <---------ANAC58         --------->ARR11(2)------->MYC3   --------->ANAC46     ---
 
gctctcttggctcgttctcttgctttcaacctcactctttctcatcgaaccgtacaaacccacacgttcgatcccatccacgactgcctcgagctgctcg  17909900
                                     <---------ICU4                          --------->ANAC58
                                     -------->HAHB4                          --------->ANAC46
                                     --------->YAB5                          --------->ANAC58
                                     --------->YAB1                          <---------MYB52(2)
      ----------->HVH21             <---------YAB1                       --------->ANAC58
    --------->TGA1a                 --------->ICU4                       --------->ANAC58
    <---------TGA1a                 <---------YAB5                     <---------ALFIN1
    <---------O2                  --------->YAB1                      --------->ZAT2--------->ANAC58
    --------->O2                 <---------KAN1                       --------->ZAT14
  <---------ALFIN1              <---------RVE1(2)                     --------->At4g35610       <---
---->NtERF2                   --------->LBD16                         <---------At4g35610       ----
>At4g35610                   <---------ANAC46                  ---------->CDC5  ------->TEIL    <---
---->WRI1                   <---------LBD16    <---------ARR11(3)  --------->ZAT18  --------->ANAC58
------>ANAC46              --------->AtLEC2    --------->ARR11(3) --------->ANAC46  --------->ANAC46
 
acgacacacttgacatgttatctcgcatccatgcggataatgatgaagaagatgtccatacatggctaagcgcagcactcacgaaccaagacacttgtga  17910000
                                                                       <---------MYB52(1)
                                                                 --------->ARR11(2)
                                                                 ------>MYB83                 ------
                                                                 ------>MYB46(1)          <---------WRKY18(1)
                                                                 <---------ARR11(2)    <---------ANAC58
                        --------->AtLEC2                       <---------MYB59    --------->ZAT2
              <---------GATA12                                 --------->AtMYB61  <---------STY1(2)
              --------->GLK1(2)                           <---------MYB52(2)      --------->STY1(2)
              <---------ARR14(2)--------->ANAC58         --------->ANAC46 <-------GAMYB<---------ANAC58
              --------->RVE1(2) --------->ANAC46  <---------ANAC58    <---------MYB52(1)<----------DOF2
              --------->ARR14(2)--------->ANAC58  <---------ANAC58-------->P--------->WRKY38(1)
------ZAT2   --------->KAN1    <---------LBD16 <---------GLK1(1) --------->MYB52(1) <---------ZAT18
----->At4g35610      <---------YAB5 <---------ANAC58     --------->ANAC58<---------MYB46(3) <-------
------At4g35610   --------->LBD16   <---------ANAC58     --------->ANAC58--------->MYB52(2) <-------
 
gcagagccttcaagaaaaatccgagtcatacaaacacggacttgcgatggatttcgtcgcaagaaacctaaccggtttgttgactagctcgcttgacttg  17910100
<- Previous    Next ->

AGI:  At2g43050.1   
Description:  ATPMEPCRD; pectinesterase. similar to pectinesterase family protein [Arabidopsis thaliana] (TAIR:AT3G59010.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45285.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain Pectinesterase, catalytic; (InterPro:IPR000070); contains InterPro domain Pectin lyase fold/virulence factor (InterPro:IPR011050); contains InterPro domain Pectinesterase inhibitor; (InterPro:IPR006501)
Range:  from: 17909561    to: 17911520    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version