AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        --------->ARR11(3)  <---------AHL20(1)
  <---------At4g35610       --------->AHL20(2)
  --------->At4g35610       --------->AHL20(1)
------DOF5.7(1)            --------->AHL25(3)
------DOF2               --------->TOE2(3)            --------->ATHB12
-----DOF5.7(1)           --------->WOX13(2)           <---------ICU4                           -----
-----DAG2                <---------WOX13(2)          <---------YAB1                         ------->TEIL
---GT1  <---------ARR11(3) --------->AHL20(2)      --------->YAB1                      <---------KAN1
ttttctgctaagatgtcttaatgtgtttcattaaattattatgggcttaaacaaacatcattggcccatttgtttttgttttttctgagcatatgtatat  16993900
                  <---------ANAC46            --------->MYB46(3)                  --------->RVE1(2)
              <---------WOX13(2)  <---------YAB1        XXXXXXXXXXXXXXXXXXXX>MIR844    <-----------GT1
         --------->YAB5--------->YAB5    --------->RVE1(2)   --------->AHL20(2)  <---------KAN1
---->ANAC55(2)--------->WOX13(2) --------->RVE1(2)   ----------->RAV1(1)      --------->YAB5
gtaacgtttgtatgagtaattgagtatgagtatgagtatcagtgtatcaacaacaacaacaaaattacttacaagtttcaacgaatataaaaacctcatg  16994000
                                                               <---------ICU4        --------->ANAC58
                                                               --------->YAB1   --------->MYB59   <-
                                                              <---------ATHB12  <---------TOE2(3)---
                                                              --------->ICU4 <----------DOF2     <--
                      --------->RVE1(2)                       <---------YAB5 ------>ZmHOX2a(1)   ---
                    <---------ARR11(3)                      --------->WOX13(1)<---------MYB52(1) <--
                    <---------RVE1(2)<----------DOF2    ----------->GT1    ===================HOX2a_HOX2a
                    --------->ARR11(3)        --------->HSFC1(2)           ------>ZmHOX2a(2)     ---
          <-----------GT1    --------->RVE1(2)<---------HSFC1(2)         <-----------------AG   ----
agaaaatagtttttttctctatagatatcaaatatcgaaactttgttgaaacttccgactagttaatcatggaagtgatcctttaggtaaggaatcccat  16994100
 <---------AHL12(3)                                                            ----------->GT1
<---------AHL12(2)                                                             <---------ANAC55(2)
--------->AHL12(2)                                                             <---------ANAC58
---------AHL20(3)                                                              <---------ANAC58
-------->AHL12(1)                                                              --------->ANAC55(2)
---------AHL25(2)                                                              <---------ANAC46
---------AHL12(1)                                                  <---------ICU4
-------->AHL25(2)                                                  --------->YAB1              <----
-------->AHL20(3)                                                 <---------YAB5               -----
------->AHL12(2)                                 --------->YAB1   <---------YAB1               -----
--------AHL12(2)                            ----------->GT1    --------->AHL12(1)      --------->ANAC55(2)
------>AHL25(1)                            --------->DAG2      <---------AHL12(1)      <---------ANAC55(2)
-------AHL20(2)                           ---------->DOF2      --------->AHL25(1)      ----------->GT1
------>AHL12(3)                   --------->GATA12 <---------YAB5<-----------GT1      <-------TEIL -
-------AHL25(2)                   --------->ARR14(2)           <---------AHL20(2)  --------->KAN1<--
------>AHL25(2)                   <---------ARR14(2)         ------->TEIL  <------------CBF    <----
----->AHL20(2)  --------->At4g35610    <---------AtLEC2 --------->YAB1   --------->MYB46(3)   ------
aaaattttatgcgtaaatcatctaaaccaaaaacccaaatttgcataaagtataatcaaacatgaatttatcatcacccattgcgtaaattcgtaacaca  16994200
     <---------ANAC46                                                                       --------
     <---------ANAC58                                                                       --------
     <---------ANAC58                                                                       <-------
  <---------WOX13(1)                                                                       ---------
 <---------ARR14(2)                                                                 <---------YAB1
 <------------CBF         --------->MYB52(2)                                      <---------ICU4
 <---------ARR11(2)     <---------MYB52(1)                                        --------->YAB1
---MYC2                --------->TOE2(3)                                          --------->YAB5
-->MYC2              <---------YAB5                                              <---------ATHB12
-->MYC3           --------->KAN1                                                 --------->ICU4-----
-------->LBD16   <----------DOF2                            <---------YAB5     --------->WOX13(1)
-------LBD16    <---------ANAC58                     <---------ANAC46    <-----------GT1   <--------
---MYC3         <---------ANAC58             <----------DOF2--------->ICU4   ------------>CBF<------
--->KAN1        <---------ANAC46    <------------CBF<---------TOE2(3) --------->WOX13(2)   <--------
tgcggattgcttatacatggcttattcgttagtagtttatattgtaagctttatttaggtgtaatgtttttgaaatttacttcaatcatgagaaaattaa  16994300
->AHL25(1)                               --------->KAN1                        ------>NtERF2
--AHL12(3)                               <---------KAN1                     --------->HSFB2a(2)
->AHL12(3)                              --------->ARR14(2)                 <---------DEAR3(1)
->AHL20(3)                              <---------ARR14(2)                 <---------LBD16
--AHL20(3)                              <---------ARR11(2)               <-----------HVH21
>AHL12(2)                    --------->ANAC46<---------ANAC58          <-------TEIL      <---------ANAC46
---->WOX13(2)                <----------ID1  <---------ANAC58       --------->KAN1<----------DOF2<--
-WOX13(2)          <---------TOE2(3)    --------->ARR11(2)       <-------TEIL<------NtERF2   -------
---AHL12(1)     <---------AHL20(2) --------->AtLEC2             --------->DOF5.7(2)    <---------ANAC46
-AHL12(2)      <----------DOF2 ------------>CBF            --------->ANAC46<---------ANAC46  <------
taaacgacgatgtgtctgttttaatgtattaaacgacaatgcaaatatgcgtttcaagcttcacgacgttcacattcgtcggggactttgttgtgtagct  16994400
                        <---------WOX13(2)                  --------->ARR14(2)
                        --------->WOX13(2)                  <---------ARR11(3)
                      <---------AHL25(1)                    <---------ARR11(2)
                      <---------AHL12(1)                    --------->GLK1(2)
                      --------->AHL25(3)                    --------->ARR11(2)
                      --------->AHL20(2)                    <---------ARR14(2)
                      --------->AHL25(1)                    --------->ARR11(3)
                      <---------KAN1        <---------WOX13(2)       <---------ARR11(3)
             --------->LBD16          --------->GLK1(1)     --------->RVE1(2)
           <---------LBD16        --------->YAB1           <---------KAN1                      <----
  <-----------GT1  --------->YAB5<---------KAN1      --------->DOF5.7(1)                   <--------
-------GLK1(2)   <------NtERF2   <---------YAB5     --------->DOF5.7(1)       --------->YAB1  <-----
-->At4g35610 ------>NtERF2 <---------LBD16  --------->WOX13(2)     --------->ANAC58        <--------
---At4g35610--------->ANAC46  <------ZmHOX2a(1)   ---------->DOF2  --------->ANAC58      --------->YAB1
gattcttacatttctccggcatcgattaattcaggaatcagagctctaattcagaaaggagagtatctacaagctctgcatttatactctaagcatgatg  16994500
                                                                 <-----------ARR10                 <
                                                                 ------->TEIL                   <---
                    <---------MYB52(1)                   <----------DOF2                        <---
                  <---------ANAC58                   <---------DEAR3(1)                        -----
                  <---------ANAC58                 <---------ANAC58                          <------
          <---------HSFB2a(2)<---------ARR11(2)    <---------ANAC58     <---------MYB52(1)   -------
-----MYB46(3) <---------GLK1(1)                   <---------ZAT2 --------->RVE1(2)        <---------YAB5
-KAN1 <----------DOF2     --------->ANAC55(2)  <---------ANAC58  <---------GATA12       --------->YAB1
----YAB1  --------->HSFB2a(2)--------->ARR11(2)<---------ANAC58 <---------GLK1(2)      <---------ATHB12
-YAB1<---------DOF5.7(1)<-----------GT1    ---------->DOF2<---------DOF5.7(1)       --------->YAB5 <
gttcttctcctttctggacttccgttttcacgtttccttctctacttaaagcttgctcggctcttacgaatctcagttatgggaaaaccattcatggttc  16994600
  <---------ANAC46           --------->ATHB12                                       --------->ORA47(1)
 <------NtERF2            <----------DOF2                                          <---------ANAC58
---------MYB46(3)         ------>ZmHOX2a(1)                                        <---------ANAC46
---MYB83                ------>ZmHOX2a(2)                                     --------->KAN1
---MYB46(1)           <---------ARR11(3)                ----------->GT1       <---------KAN1       <
---->MYB59            --------->ARR11(3)               ------->TEIL         <---------RVE1(2)     <-
---ARR11(2)         <---------YAB1          ----------->GT1                 <---------GLK1(2)   ----
-->ARR11(2) <---------DEAR3(1)            <---------ANAC58                <---------TOE2(3)    -----
---------DEAR3(1) --------->CCA1(2)       <---------ANAC58     <-----------RAV1(1) <---------ANAC58<
ggtcgtcgtgttgggatggcgatatgatcctttcattgcaacctcgcttgttaatatgtatgtaaaatgtgggtttttagattatgccgtccaagtgttc  16994700
   <------MYB83                 <---------LBD16
  <---------MYB46(3)         <---------ZAT2
  <---------AtMYB61          <---------At4g35610                                                   <
 <---------MYB55(1)          --------->ZAT2                      <---------------AtSPL8       ------
 <--------P              --------->ARR11(2)                      <---------------AtSPL3     <------ZmHOX2a(1)
 <---------MYB52(1)      <---------ARR11(2)                      --------------->AtSPL8   <---------TOE1(3)
<-------GAMYB            <---------ARR14(2)                      <---------MYB46(3)       <---------TOE2(3)
---------MYB46(3)        --------->GLK1(2)                    --------->ATHB12        --------->CCA1(2)
--------DEAR3(1)         --------->ARR14(2)               --------->YAB5             --------->GATA12
-------->AtMYB77        <---------KAN1   <---------At5g28300<---------WOX13(1)       <---------GATA12
------>HVH21        <---------ZAT14     <-----------GT1   --------->ATHB12           --------->ARR11(3)
---------DEAR3(2)  --------->ALFIN1  <---------KAN1      <---------YAB1              <---------ARR11(3)
gacggttggtctcagagtcagagtggagtttctgctcgggatgttactgtttggaactctatgattgatgggtacttcaaatttcgaagatttaaggaag  16994800
<- Previous    Next ->

AGI:  At2g40720.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT4G21300.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41519.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 16994347    to: 16996929    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version