AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                       --------->ALFIN1                  <---------WRKY18(1)
                     <---------ANAC46                   --------->WRKY38(1)
                     <---------ANAC58                   ----------->HVH21
                     <------MYB46(1)                    --------->WRKY12
                     <------MYB83                     <-------GAMYB
                     <---------ANAC58                <---------MYB46(3)
                    --------->MYB111(1)             <---------YAB1
                    --------->MYB59                 <---------AtMYB61             <---------ICU4
                    --------->MYB52(2)           --------->ALFIN1                <---------YAB5
                    --------->MYB55(2)        <---------ANAC46                 <---------WRKY38(1)
<---------YAB5      --------->MYB111(2)       <---------DEAR3(1)               <---------WRKY12
<---------TOE2(3)   --------->MYB46(2)     ----------->TGA1              <---------LBD16
<---------YAB1      <---------AtMYB61      ----------->HVH21           --------->ZAT2
->TOE2(3)          <---------MYB55(1)     <-----------HVH21          --------->AtMYB61
>MYB46(3)        <-----------HVH21     <---------At4g35610           <---------ALFIN1    --------->ANAC46
-MYB55(2)    <-----------RAV1(2)       --------->At4g35610    --------->LBD16<-----------HVH21<-----
 
attatcgttggagaggccagggttaggtgggcaaaagtttgtagctgtgacggtgatggttgacccgagacaccacctcgggtcatcgttacacttcatc  16957200
              <-------MYC3
              ------->MYC3
              <-------MYC2
              ------->MYC2
             ==========================================bZIP_DOF
             =================MYC_MYB
             --------->ANAC58
             --------->TGA1a
             <---------O2
             --------->O2
             <---------TGA1a
             --------->ANAC58
             --------->ANAC46
             <---------ANAC55(2)
           <---------ALFIN1
         ----------->RAV1(1)
         --------->DEAR3(1)
         <---------ALFIN1
        <------NtERF2                                             --------->ARR11(2)
        ----------->HVH21                                         <---------ARR11(2)
       ------>NtERF2                                              --------->ARR14(2)
       <-----------HVH21                                         ----------->HVH21
      --------->ANAC58                                         --------->ANAC58
      --------->ANAC46                                         --------->ANAC58
      --------->ANAC58                                --------->ALFIN1
     ------->MYC3                                   <---------ANAC46
     <-------MYC3                                  --------->ATERF1(1)
     <-------MYC2                                  <------NtERF2--------->LBD16
     ------->PIF4                                 ------>NtERF2--------->ANAC55(2)
     <-------PIF4                                 <---------RAP2.6(3)
     ------->PIF5                                --------->RAP2.3(2)
     ------->MYC2                                --------->RAP2.6(2)
     <-------PIF5                                --------->DEAR3(1)                                -
    <---------ATERF1(1)                          --------->RAP2.3(3) --------->TOE2(3)             <
    --------->ANAC58    <---------MYB46(3)      --------->RAP2.3(1)  --------->TOE1(3)            --
    --------->ANAC58   <---------MYB52(1)   ---------->DOF2    <---------ANAC55(2)               ---
    --------->ANAC46  <-------GAMYB   <---------RAP2.6(3)      --------->ANAC46           --------->RVE1(2)
----At4g35610--------->ANAC55(2)    --------------->AtSPL3 <---------SPL7(1) --------->AtLEC2    ---
 
tcatagcacgcgccacacgtgagtccgttgttgaatagagccgtacttaaagccgccgtgttcgtcccgtaaccttggccatacaaatttccatagccac  16957300
                                         ------->MYC3
                                         ------->MYC2
                                         <-------MYC2
                                         <-------MYC4
                                         <-------MYC3
                                         ------->MYC4
                                         ------->PIF5
                                         <-------PIF5                                              -
       --------->ATHB12       <---------MYB59                                                      -
    ----------->RAV1(2)      --------->WOX13(2)                                                    -
   --------->LBD16           <---------At4g35610                                                   <
   ------>NtERF2 --------->ANAC58       <---------O2                                         <------
  <---------ALFIN1           <---------WOX13(2)---------->DOF2<---------MYB59               <------MYB46(1)
  --------->DEAR3(1)         --------->At4g35610 --------->DOF5.7(1)                        <------MYB83
-------->ARR14(2)--------->ANAC58       --------->O2         --------->WOX13(2)  <---------RVE1(2) <
---------ARR14(2)--------->ANAC46       --------->TGA1a      <---------At4g35610 <---------ARR11(3)<
------->ZAT2   <---------ANAC58         <---------TGA1a      --------->At4g35610 --------->ARR11(3)-
------>ANAC58  <---------ANAC58         ==================bZIP_DOF       ------->TEIL      <--------
------>ANAC58  <---------AtLEC2         --------->ANAC46<---------WOX13(2)      <<<<<<<<<RAP2.2   <-
 
aagctccgcctgatttgtgcatgccacttgttagctaacttacacgtggataaagagacaatttagctaacttatgcatttttagatattgggattggtc  16957400
                                           =========================MYC_MYB
                                           --------->bZIP60(1)
                                           <---------ANAC58
                                           <---------ANAC55(1)
                                           <---------TGA1a
                                           <---------ANAC46
                                           --------->O2
                               --------->RAP2.3(2)
                               --------->RAP2.6(2)
                               <---------ANAC46
                               ----------->GT1
                              <------NtERF2<---------O2
                              --------->RAP2.3(1)
                             ------>NtERF2 --------->TGA1a
                            --------->ANAC46
                            --------->DEAR3(1)
                            --------->RRTF1(3)
                            ------------------>SPL14
                            <---------DEAR3(1)
                            --------->RAP2.3(2)
                           --------->ATERF1(1)
                           --------->DEAR4(2)
                           --------->ERF1  ==========================MYC_MYB
                           --------->RAP2.3(1)
                     <---------KAN1        --------->ANAC55(2)
             --------->ATERF1(2)           <---------ANAC55(2)
             <---------ATERF1(2)           <---------bZIP60(2)
             --------->HSFB2a(2)--------->LBD16
             <---------HSFB2a(2)--------->At5g28300
             <---------ANAC46<---------ATERF1(1)
            <------NtERF2 <---------ATERF1(1)
       <-----------RAV1(1)<---------RAP2.3(1)                --------->TOE2(2)
  ------->TEIL--------->LBD16--------->ABI4(1)   <---------ALFIN1
-------->ANAC46     <-----------ARR10      <---------ANAC58  ------->GAMYB
-------->ANAC55(2)<---------HSFB2a(1)      <---------bZIP60(1)      <---------ATERF1(1)
-------->ANAC58   --------->HSFB2a(1)     <------NtERF2     <---------MYB55(2)                   <--
---------ANAC55(2)<---------HSFC1(2)    --------->ALFIN1    --------->MYB46(3)                  <---
-----HVH21  <---------LBD16--------->ORA47(2)----------->HVH21   <-----------HVH21           -------
---------ANAC58   --------->HSFC1(2)   <-------MYC3        ------>MYB83                     <-------
---------ANAC58  --------->ANAC58      ------->MYC3        ------>MYB46(1)        <---------ANAC58
-------->ANAC58  --------->ANAC58     <---------O2         -------->P             <---------ANAC46
-AtMYB61   ------>NtERF2 --------->ANAC46 <-----------------------TaNAC69(2)      <---------ANAC58--
--------TOE1(2)<------NtERF2--------->RAP2.3(3) --------->MYB46(3)<---------MYB52(1)     <------ZmHOX2a(1)
 
atacgtacccatggtgccggaagcatcttcgccgccgtaaaacgtggcgtgaccaccttgccaacctccgtcgtctccatgagttccttggaggaataat  16957500
                      <---------AHL12(2)
     <---------WOX13(2)
     --------->WOX13(2) <---------AHL20(2)
   <---------AHL25(1)--------->AHL20(3)
   <---------AHL20(2)<---------AHL25(2)
   <---------AHL12(3)--------->AHL20(1)
   --------->AHL25(1)--------->AHL25(2)
   <---------YAB1    <---------AHL12(1)
  --------->AHL25(3) <---------AHL20(3)             ---------->ID1                              <---
 <---------KAN1      --------->AHL12(1) <---------ZAT18                                       <-----
<---------ARR11(2)   <---------ARR11(3) <---------ZAT14                                       ------
<---------ARR14(2)   --------->ARR11(3) --------->ZAT18                      <---------YAB5   ------
--------->ARR14(2)   <---------AHL20(1) --------->ZAT14                     <---------WOX13(2)------
--------->ARR11(2)  --------->AHL12(1)<---------------AtSPL8               ----------->GT1    ------
-------ANAC55(2)    <---------AHL12(1)--------------->AtSPL8               --------->MYB52(2) ------
------LBD16 <---------YAB1           <---------ANAC58                    <--------P           <-----
-->YAB1     --------->ICU4           <---------ANAC46               --------->ALFIN1     <---------ANAC46
--KAN1   <---------TOE2(3)           <---------ANAC58              <------ZmHOX2a(1) <-------GAMYB
--------->GT1--------->ATHB12  <---------YAB1     <-----------RAV1(1)  ----------->GT1 <---------MYB46(3)
 
acggatataattgagattattgaatattttaagtatgatggagtgtacatgttttgttgttttttgttgaggaggggttagttatttcggttgtgagtat  16957600
                                   <---------------AGL15                                 --------->ANAC58
                                   --------------->AGL15                       --------->ATHB51
                                  <-----------------AGL3                       <--------ATHB1
   --------->ATHB12               *TSS                                         --------->YAB1
<---------At4g35610               <-----------------AGL2                       <---------ICU4
------ANAC46                      ----------------->AGL3                      <---------AHL12(1)
----ARR14(2)                      ==================================================================
--->GLK1(2)             --------->AHL20(2)                                    <---------AHL20(2)
--->ARR14(2)            --------->YAB1                                        --------->AHL12(1)  --
--->MYB52(1)            <---------AHL20(3)                                    <---------ATHB51 -----
--->ARR11(2)     ----------->GT1<---------GATA12                  --------->KAN1<------------CBF <--
--->RVE1(2)    --------->GLK1(2)--------->GATA12        <-----------TBP       <---------KAN1  ------
----ARR11(2)   <---------ARR14(2)<---------KAN1     ----------->GT1       <---------KAN1 --------->ANAC58
 
cggagatgatttgatgagaatcgtgaataatatggaatctacaaatggaaggaatgggtatatataggggtactcgagtgaataattgtgccaagcgata  16957700
                                                                              <---------AHL20(2)
                                                                              --------->KAN1
                                                                            --------->AHL12(2)
                                                                           <---------AHL12(2)
                                                                           --------->AHL12(2)
                                                                          --------->AHL20(2)
                                                     <----------DOF2      --------->AHL25(1)
                                                     <---------DAG2       <---------AHL20(2)
               =====================================================MADS_MADS--------->AHL25(3)
    <---------AHL25(1)                               <---------DOF5.7(1)  <---------AHL25(3)
    --------->AHL25(1)            --------->ALFIN1  <---------DAG2        <---------AHL25(1)
    <---------AHL25(3)            <---------KAN1    --------------->AGL15 <---------AHL12(3)
    <---------AHL20(3)          <---------ANAC46    <---------------AGL15--------->AHL25(3)
    --------->AHL20(2)          <---------ANAC58    <---------DOF5.7(1)  --------->AHL20(2)
    <---------AHL20(2)          <---------ANAC58   ----------------->AGL1<---------AHL20(2)
===============================MADS_MADS           <-----------------AG  <---------AHL12(1)
------->YAB1   <---------------AGL15               <-----------------AGL1--------->AHL12(1)
---->YAB1      --------------->AGL15              <-----------------AG  <---------WOX13(1)
-------YAB5 <-----------GT1<------------CBF      <-----------GT1   --------->WOX13(2)
--->ICU4 --------->YAB5  <-------TEIL    --------->KAN1          <---------AHL20(2)        <--------
 
atcatatttaaatgtttactatatgaagtacattggggtgtctctaattctttcacctttttgggtatttagttgatttatttattcgtatttttgacca  16957800
                                                     <---------ARR11(3)
                                                     --------->ARR11(3)
                                                --------->ICU4
                                            <---------ARR14(2)
                                            <---------ARR11(3)
                                            --------->RVE1(2)
                                            --------->ARR14(2)
                                            --------->ARR11(3)
                                            <---------ARR11(2)
                                           <---------GLK1(1)
                                           --------->KAN1
                                           <---------KAN1
                              ---------->DOF2  --------->TOE2(3)
                <----------DOF2 --------->GATA12------>ZmHOX2a(1)
                <---------DOF5.7(1)     --------->YAB5
 <---------ANAC58         ----------->GT1 ------->TEIL       <---------RVE1(2)
 <---------ANAC58<---------DOF5.7(1)   <---------ATHB12 <----------DOF2    --------->TOE2(3)
---GT1         <---------ANAC46 <---------GATA12<---------YAB1     <----------DOF2             <----
 
atttgcgagagaattgtgccttttatttctcgttaaatcccaatgaatatccttattatcttttggtattctttcatacattaatacacacataggggtt  16957900
                                                   <---------ANAC58
                                                   <---------ANAC46
                                                   <---------ANAC58
                                               <---------ANAC46                                 ----
                                               <---------ANAC58                              <------
                                               <---------ANAC58                             --------
                  --------->RVE1(2)         ----------->HVH21                              <--------
        ------->GAMYB                     <---------ANAC58          ---------->DOF2        ---------
       --------->ANAC58            ----------------->AGL1        --------->ANAC58       <------NtERF2
       --------->ANAC58--------->WOX13(2) <---------ANAC58--------->YAB5               ------>NtERF2
-----DOF5.7(1)   <---------KAN1    <XXXXXXXXXXXXXXXXXXXXMIR774   --------->ANAC58 ------->TEIL  ----
 
tttttctccaacgaaatggaacatcaaatttagaaatggccaaatgggtgacttgtgtggataactagaagcaaagtcaacaatgtatgccaccgttaac  16958000
                         --------->AHL12(2)
                      <---------AHL20(3)
                      --------->AHL25(2)
                      --------->AHL25(1)
                      <---------AHL25(2)
                      <---------AHL25(1)
                      <---------AHL20(2)
                      --------->AHL20(3)
                      --------->AHL25(3)
                      <---------AHL25(3)
                      <---------AHL20(1)
                  <---------AHL25(3)
                  <---------AHL25(1)
                  --------->AHL12(1)
                  <---------AHL12(1)
                  --------->AHL20(2)
                  <---------AHL20(2)
                  --------->AHL25(1)
                  <---------AHL12(3)
                  --------->AHL12(3)
                 --------->AHL25(3)
                --------->AHL12(2)
                --------->AHL12(3)
                <---------AHL12(3)
              --------->AHL12(3)             <---------AHL20(3)
              <---------AHL20(2)             --------->AHL12(3)
              --------->AHL25(1)             --------->AHL20(3)
              <---------AHL12(3)             --------->AHL20(2)
             <---------AHL25(2)              <---------AHL20(2)
             <---------ARR11(3)              <---------AHL12(3)                     <---------AHL20(2)
             --------->ARR11(3)              --------->AHL25(1)                     <---------AHL25(1)
             --------->AHL25(3)              <---------AHL25(1)                     --------->AHL20(2)
 <---------At4g35610  --------->AHL12(3)  --------->GATA12                          --------->AHL25(1)
 --------->At4g35610  --------->AHL20(2)  <---------GATA12                          <---------AHL25(3)
----->TOE2(3)--------->AHL25(2)      ------>NtERF2                                 <---------AHL12(2)
---DOF5.7(2) <---------AHL20(1)    <---------ANAC58                               --------->WOX13(2)
->WRKY12    --------->CCA1(2)      <---------ANAC46                         ----------->RAV1(1)
-MYB52(1)  --------->ARR11(3)      <---------RAP2.6(2)                  --------->ZAT18           --
>DOF5.7(2) <---------ARR11(3) <-----------RAV1(1)                <---------YAB1   <---------WOX13(2)
----->TOE1(3)--------->AHL20(1)    <---------ANAC58     ----------->GT1 <---------ZAT18         ----
 
cttgagcagagtaagatatatttattttattttttgttgcggccagatttatatatgtattgtaaaatatgtttgtggacaacaaaattaaacagttaga  16958100
<- Previous    Next ->

AGI:  At2g40610.1   
Description:  ATEXPA8 (ARABIDOPSIS THALIANA EXPANSIN A8). Identical to Expansin-A8 precursor (EXPA8) [Arabidopsis Thaliana] (GB:O22874); similar to ATEXPA2 (ARABIDOPSIS THALIANA EXPANSIN A2) [Arabidopsis thaliana] (TAIR:AT5G05290.1); similar to expansin 2 [Zinnia elegans] (GB:AAF35901.1); contains InterPro domain Expansin 45, endoglucanase-like (InterPro:IPR007112); contains InterPro domain Rare lipoprotein A (InterPro:IPR005132); contains InterPro domain Expansin/Lol pI; (InterPro:IPR007118); contains InterPro domain Expansin; (InterPro:IPR002963); contains InterPro domain Pollen allergen/expansin, C-terminal (InterPro:IPR007117); contains InterPro domai
Range:  from: 16955941    to: 16957635    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version