AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               ----------->GT1
          <---------AHL12(3)
          --------->AHL12(3)
          <---------AHL20(2)
          --------->AHL20(2)
          --------->AHL25(1)
          <---------AHL25(3)
          <---------AHL25(1)
         --------->AHL25(3)
         <---------AHL25(3)
        <---------AHL12(3)
        --------->AHL20(3)
        --------->AHL12(3)
        <---------AHL20(3)              <---------AHL12(1)
        --------->AHL20(2)              --------->AHL12(3)
       --------->AHL12(2)               <---------AHL20(2)
       <---------AHL12(2)               --------->AHL12(1)
      --------->AHL25(2)               --------->AHL20(1)
      <---------AHL12(2)               <---------AHL20(1)            <---------AHL12(2)
      --------->AHL12(3)               --------->AHL25(3)            --------->AHL12(2)
      <---------AHL12(3)              <---------AHL20(2)           --------->AHL20(3)
     <---------AHL25(2)               --------->AHL12(3)           <---------AHL20(3)
     --------->AHL25(3)               <---------AHL12(3)           <---------AHL20(2)
     --------->AHL25(2)             --------->AHL20(2)          --------->YAB1
     <---------AHL25(1)             --------->AHL12(3)          --------->AHL20(2)
     <---------AHL12(1)             <---------AHL12(3)        <---------WOX13(2)
     --------->AHL12(1)            <---------AHL20(1)         --------->WOX13(2)
     <---------AHL25(3)            <---------AHL25(3)       --------->AHL25(1)
     <---------AHL20(2)            --------->AHL20(1)       <---------AHL12(1)
     --------->AHL25(1)           --------->AHL20(2)        <---------AHL20(2)
     <---------AHL20(3)           --------->AHL12(3)        --------->AHL20(2)
     --------->AHL20(3)           --------->AHL25(1)        --------->AHL12(1)
     --------->AHL12(3)         ------>MYB83                <---------AHL25(3)
     --------->AHL20(2)         ------>MYB46(1)             <---------AHL25(1)
     --------->AHL20(1)       <---------MYB59             --------->AHL12(2)
     <---------AHL20(1) <---------AHL20(2)              <---------AHL20(2)                  <-------
    --------->AHL25(3)  <---------AHL25(3)              --------->AHL20(2)               <----------
   <---------AHL12(2)  --------->AHL25(3)           <----------DOF2--------->AHL20(2)    -----------
   --------->AHL12(2)  --------->AHL20(2)          <---------DOF5.7(1)     ---------->DOF2  --------
<---------ARR11(3)    <---------AHL12(2)<---------AHL12(3)<---------WOX13(2)        --------->KAN1
--------->ARR11(3)    --------->AHL12(2)<---------AHL25(1)--------->WOX13(2)      --------->ANAC55(2)
 
taagataataaatttatattgtaatattaaataccaaatatatatattttggtgtctttttaattaataaaaaaataacaaagacacttattctaaatta  15913500
                                                                                           <--------
                                                                                  <---------TOE1(2)
                                                                                  <---------TOE2(2)
         --------->MYB52(1)                                                --------->DOF5.7(1)
         <-----------GT1                                            ----------->GT1--------->ANAC58
       <---------MYB52(2)                         ----------->RAV1(2)----------->GT1      <---------AHL20(2)
      --------->WOX13(2)               <---------ICU4             --------->DOF5.7(1)    <---------RVE1(2)
      <---------WOX13(2)               --------->YAB1            --------->MYB52(1)--------->ANAC58
     --------->WOX13(1)               <---------ATHB51     ---------->DOF2 --------->AHL12(1)
 ----------->GT1                      <---------ATHB12   --------->ANAC58 <---------AHL25(1)
--WOX13(2)             <------ZmHOX2a(1) <---------YAB1  --------->ANAC58 --------->AHL25(1)
-----AGL15           <---------TOE2(3)--------->ICU4 <-----------HVH21    --------->AHL20(3)
---->AGL15       --------->YAB1      <---------WOX13(2)  --------->ANAC46 <---------AHL20(3)<-------
->WOX13(2)<---------TOE2(3)          --------->WOX13(2)  <---------ANAC55(2)    --------->TOE1(2)  <
 
agaagagtcaattaacgaaataataaggaatgaaattctcaattatgaaaaacacctgtcacgaaagtaaacgggaaaaaaatcgcacgatagataattg  15913600
                                    <---------YAB1
                                   <---------TOE2(3)
                                  --------->YAB1
                                  <---------ICU4
                                 --------->ICU4                                  <---------WOX13(2)
                                <---------AHL20(3)                     <----------DOF2
                                <---------AHL25(2)                    <-------GAMYB
          --------->ZAT18       --------->AHL20(3)                   ----------->GT1
          <---------ZAT18       <---------AHL20(2)                   <---------MYB46(3)
   <---------ZAT14             --------->YAB1              ------------>CBF<---------TOE2(3)
   --------->ZAT14            <---------AHL20(2)   --------->GATA12  <---------DEAR3(2)
-ICU4     --------->ZAT14    --------->AHL20(2)    <---------RVE1(2)<---------RAP2.6(2)       ------
--WOX13(2)<---------ZAT14   --------->AHL12(2)     <---------GATA12 <---------DEAR3(1) --------->YAB5
---------DEAR3(1)      ----------->GT1        <------------CBF --------->ALFIN1  <------------CBF
 
catcggtgctcagtgctctgtttatctcgttatataataatgttagagaaattggatgtgaatgcaatggggcggtttaatgtgaattgatgagtagaca  15913700
                                                   --------->MYB46(3)
                                                <---------ETT(1)
                                                ------->GAMYB<---------ANAC58
                                            <---------MYB111(2)
                                            <---------MYB55(2)
                                            --------->MYB46(3)
                                            <---------MYB46(2)
                                            <---------MYB111(1)
                                            <---------MYB52(2)
                  <---------YAB5     <---------ZAT14         <---------ANAC58
             <------MYB83            --------->ZAT14   --------->AtMYB61
             <------MYB46(1)         --------->ZAT18   <---------ALFIN1
            --------->MYB59  --------->ANAC58   --------->At1g77200
        <------MYB83         --------->ANAC46  --------->DEAR3(2)                          <--------
        <------MYB46(1)      --------->ANAC58 --------->MYB52(1)                 ------------>CBF---
       --------->MYB59     --------->MYB46(3)--------->MYB55(1)  <---------ALFIN1------>ZmHOX2a(1) <
--->ANAC46  --------->MYB46(2)       <---------ZAT18  --------->MYB46(3)        --------->TOE2(3)---
 
caacaagagtttggtttggtaatggtagcaacaagccaagagcactaactaccgacaaccactcgcgtccacatttgaattttcctcaattcccccactc  15913800
                                                                                               <----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                             <------
                                                                                             <------
                                                                                            --------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           <--------
                                                                                         <------ZmHOX2a(2)
                                                                                         --------->CCA1(2)
                                                                                        --------->ARR11(2)
                                                                                        <---------ARR14(2)
                                                                                        --------->AGP1
                                                                                        <---------ARR11(2)
                                                                                        <---------ARR11(3)
                                                                                        --------->RVE1(2)
                                  --------->RVE1(2)                                     --------->ARR14(2)
          <----------DOF2        <---------KAN1                                         --------->GATA12
      <---------At4g35610      <---------GLK1(2)                         <---------GLK1(2)<-------TEIL
    <-----------GT1         <---------ANAC58                             <---------RVE1(2)------>ZmHOX2a(2)
 <---------DOF5.7(1)        <---------ANAC46                           <---------YAB1   <---------GATA12
<----------DOF2            <---------LBD16                         <---------RVE1(2)    --------->ARR11(3)
<---------DAG2         <---------AtLEC2                           --------->KAN1       --------->KAN1
-ALFIN1  <---------DOF5.7(1)<---------ANAC58                 <---------ANAC58         ----------->ARR10
------>ANAC58       <----------DOF2                          <---------ANAC58   ================HOX2a_HOX2a
---------DOF5.7(1)<---------ATHB12<---------ARR11(3)         <---------ANAC46   =================HOX2a_HOX2a
------>ANAC58 ------------>CBF<------NtERF2              ------>ZmHOX2a(1)      ------>ZmHOX2a(1)
 
acgctttttagctctttctcaatctttcatggcggattatctctctctctctcacttctccttctcgtgtgattctgattctcctctctaagatccgtat  15913900
<---------DOF5.7(1)
-----CCA1(2)
--->ARR14(2)
----ARR11(1)
--->RVE1(2)
--->ARR11(2)
----ARR14(2)
----ARR11(2)                     --------->MYB46(3)
->TEIL                           <---------ATHB12
------ARR10                     -------->P
---ARR14(1)                    --------->WOX13(1)
---CCA1(2)                  --------->WOX13(2)
->LBD16                    --------->WOX13(1)                               <<<<<<<<<TBF1
-ANAC55(2)               ------------>CBF                              <----------DOF2
-ANAC55(1)          --------->ZAT18                                   <---------DOF5.7(1) <---------
-ANAC58             <---------ZAT18               <---------YAB1  <-----------GT1    <<<<<<<<<TBF1
>ANAC55(2)        <---------At4g35610   <---------MYB46(3)   --------->WOX13(2)   <<<<<<<<<TBF1
-ANAC58   <---------DOF5.7(1)<---------ATHB12--------->ZAT6  <---------WOX13(2)<<<<<<<<<TBF1     ---
 
ctctcttactctcccttctcaagctcacttcaatcaaccatggctgtttcactaccattgtttcaatttatactctttcttcttcttcttcttctttcaa  15914000
                                                    <---------At4g35610                <------ZmHOX2a(2)
                                      <---------ZAT14                                 <---------GATA12
                                    --------->TGA2(1)                      --------->ANAC58
                                    --------->bZIP60(1)                    --------->ANAC46        -
                                    <---------bZIP60(1)  --------->bZIP60(1)          --------->GATA12
              --------->KAN1--------->ANAC58        --------->At4g35610    --------->ANAC58       <-
            --------->ANAC55(2)     <---------TGA2(1)    <---------bZIP60(1)          --------->RVE1(2)
-DOF2       --------->TOE2(3)    ----------->HVH21  ------>NtERF2 --------->ATHB12   <---------At4g35610
------>MYB52(1)             --------->ANAC58    ------>ZmHOX2a(1)<---------YAB1      --------->At4g35610
 
gaacggtttatgcatacttaatcggagtcggaagctatgacatcactggtcctgccgctgatgtcaacatgatgggctacgcaaactcagatcaaatcgc  15914100
                         ------->PIF5
                         <-------PIF5
                         ------->MYC3
                         <-------MYC2
                         ------->MYC2
                         <-------MYC3
                  <---------ANAC58
               --------->ARR11(2)
               <---------ARR14(2)
               --------->ARR14(2)
           <---------LBD16                                    <---------ANAC58
         --------->ARR14(2)                                   <---------ANAC58
         --------->ARR11(2)                                   <---------ANAC46
         <---------ARR14(2)                           --------->MYB52(1)
         <---------ARR11(2)             <----------CDC5<---------At5g28300
      <---------ICU4  <------------OsbHLH66           --------->ARR14(2)
     <---------YAB5  --------->ZAT2    <---------At4g35610   <------NtERF2
 <---------MYB52(1)  <---------ZAT2    --------->At4g35610  <-----------HVH21
--------->LBD16<---------ARR11(2)     <---------DEAR3(1) ------->GAMYB                     <--------
-------->HSFB2a(2)<---------ANAC58  <-----------HVH21 --------->ARR11(2)              <---------AtLEC2
--------LBD16--------->LBD16      <---------YAB5      <---------ARR11(2)--------->WOX13(1) <--------
 
ttccggtattcatttccggttacgagctcgtgccttcatcgtcgctgagcctcaaggtaaccgcgtcgtgtttgtcaatctcgacgcttgtatggcttct  15914200
                                                                <---------AHL25(3)
                                                  --------->WOX13(2)
                                                  <---------WOX13(2)
                                                --------->AHL25(1)
                                                <---------AHL25(3)
                                                <---------AHL25(1)
                                                --------->AHL12(1)
                                                --------->AHL25(3)
                                                --------->AHL20(3)
                                                <---------AHL20(2)
                                                <---------AHL20(3)
                                                --------->AHL20(2)
                                                --------->AHL12(3)
                                                <---------AHL12(1)
                                                <---------AHL12(3)
                                              <---------AHL12(2)<---------AHL25(1)
                                              --------->AHL12(2)--------->AHL25(1)
                                            <---------AHL12(1)  <---------AHL20(2)
                                            <---------KAN1     --------->AHL20(2)
               <---------ARR11(3)          ------->TEIL      <---------GATA12
               --------->ARR11(3)        --------->YAB5      <---------ARR11(3)
           ---------->DOF2              <---------YAB1       --------->ARR11(3)
          --------->YAB1              --------->CCA1(2)    <---------YAB5       <---------ZAT6
         <---------ATHB12          --------->ANAC58      ---------->DOF2      <---------ANAC46
 ----------->GT1                   --------->ANAC58   --------->At4g35610   <---------ZAT14     ----
<---------ATHB12               --------->ANAC58--------->AHL25(3)    <----------DOF2       <--------
-ANAC58  <<<<<<<<<ARR2         --------->ANAC58--------->AHL20(2)  <---------YAB5          <--------
-ANAC58 --------->RVE1(2)    ---------->DOF2--------->AHL12(1) --------->AHL25(3)   --------->MYB52(2)
 
caaatcgttacaatcaaagttcttgagcgtctcaaagcaaggtatgaatatttaattagctaaagatttaatctttgagtagagtgttagtggaatcagt  15914300
                              ---------->DOF2
                        <---------AHL20(3)
                        --------->AHL25(1)
                        --------->AHL20(3)
                        --------->AHL25(2)
                        <---------AHL12(1)
                        --------->AHL12(1)                                                     -----
                        <---------AHL25(1)                                                     -----
                        --------->AHL20(2)              <---------REM1(2)                      <----
                        <---------AHL25(2)           <----------DOF2                           <----
----->YAB5              <---------AHL25(3)         --------->At4g35610                        ------
-YAB5                   <---------AHL20(2)   <---------AtMYB61               --------->ICU4 <-------
-KAN1  --------->YAB1 --------->AHL12(2)  <---------RVE1(2)          <---------KAN1  <---------GLK1(1)
 
gattaatccatgagaatggatagctaattttttaaaagttcaataggtatggtgagctttacacagagaagaatgtagcaataagtggaattcacacaca  15914400
<- Previous    Next ->

AGI:  At2g38010.1   
Description:  ceramidase family protein. Identical to Neutral ceramidase precursor [Arabidopsis Thaliana] (GB:Q304B9;GB:Q3EBK8;GB:Q7XJQ9); similar to ceramidase family protein [Arabidopsis thaliana] (TAIR:AT1G07380.1); similar to ceramidase family protein [Arabidopsis thaliana] (TAIR:AT5G58980.1); similar to neutral ceramidase [Triticum aestivum] (GB:ABX76295.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15765.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21530.1); contains InterPro domain Neutral/alkaline nonlysosomal ceramidase (InterPro:IPR006823)
Range:  from: 15913940    to: 15917009    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version