AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    --------->ANAC58
    --------->ANAC58
   --------->SPL7(1)
 <---------SPL7(1)
---------------AtSPL3
--------ANAC46
--------->OsCBT
--MYC3
--MYC2
--PIF5
->MYC3
--MYC4
->MYC4                     ---------->DOF2
->PIF5                   <---------ZAT2
->MYC2                   --------->ZAT2
-->ANAC55(2)            --------->ANAC46
-->ANAC46          --------->ARR14(2)                   --------->KAN1
-->O2              --------->GATA12             <-----------GT1                  <----------DOF2
---O2              --------->RVE1(2)        <---------GLK1(2)              <----------DOF2
---TGA1a           <---------GATA12      --------->HSFB2a(2)              <---------DOF5.7(1)
-->TGA1a           <---------ARR14(2)  -------->P    <----------DOF2    ------->TEIL <----------DOF2
-ALFIN1           --------->KAN1------------>AtMYB77<---------DOF5.7(1)<---------CCA1(2)  <---------
 
gtctggtacggtagagtagccaaatcccagcaaagtcacagttaccagaatttactctttcattctgaattgttgtatctttttctttcttttcttttga  15765300
                                                                                          <---------ZAT18
                                                                                <---------AHL20(3)
                                                                                <---------AHL25(2)
                                                                                <---------AHL20(2)
                                                                                --------->AHL20(3)
                                          ---------->DOF2                     --------->AHL25(3)
                                          --------->YAB1                      <---------AHL25(1)
                                          <--------ATHB1                      <---------AHL25(2)
                                          <---------ICU4                      <---------AHL20(3)
                                         <---------ATHB51                     --------->AHL20(3)
                                         --------->ICU4                       <---------AHL20(2)
                                 <---------HSFB2a(2)                          <---------AHL12(3)
                                 --------->HSFB2a(2)                          --------->AHL12(3)
                             <----------DOF2                                 --------->AHL12(2)
                            <---------DOF5.7(1)                              <---------AHL12(2)
  --------->GATA12        <---------ARR11(3)     <---------WOX13(2)        --------->AHL20(1)
  --------->ARR14(2)      --------->ARR11(3)   <---------YAB1              <---------AHL20(1)
  <---------ARR14(2)   >>>>>>>>>WRKY6  --------->YAB1            --------->ZAT6 --------->AHL25(2)
-DOF2                --------->WRKY38(1) <---------ATHB12 <----------DOF2 --------->AHL12(2)      --
 
actcaaatccttgttatctccctgttgactatctttttagaacaataatgctcattagaagcttttcaactctagttatatattattttccaatgcacaa  15765400
                                                                    --------->TOE2(3)
                                                                  <---------GATA12       --------->RVE1(2)
                                                                 <---------GLK1(1)  <-----------GT1
                                                          <---------At4g35610    <---------WOX13(2)
                                                          --------->At4g35610    --------->WOX13(2)
                                                          --------->ZAT2      --------->LBD16
           <-------TEIL          <---------KAN1      --------->MYB46(3) <---------At4g35610
           <---------YAB5   --------->YAB1   --------->RVE1(2)   --------->GLK1(1)<---------ATHB12--
 <-----------GT1         --------->YAB5     --------->KAN1<---------ZAT2--------->At4g35610---------
------->YAB1      --------->AtLEC2      --------->AtLEC2--------->MYB46(3)------->GAMYB  <---------GATA12
 
attataacatttgattcattcattcaaacaattagaacatttcatacaaatccctaacaacagctgagaaatctcaactcccccaattaacaaatctcaa  15765500
                                                                               --------->ANAC55(2)
                                                                               <---------ANAC55(2)
                                                                           --------->KAN1
                                                                         <-----------HVH21
                                                                     <-----------RAV1(1)
                                                                    ------>ZmHOX2a(2)
                                                                  <---------ARR11(2)
                                                                  --------->ARR14(2)
                 <----------DOF2                                  <---------ARR14(2)           -----
         <------NtERF2<-----------HVH21                           --------->ARR11(2)           <----
         ----------->HVH21                                        --------->GATA12<---------ARR11(1)
        <-----------HVH21                                         <---------GATA12--------->RVE1(2)
       --------->RAP2.6(2)                                        <---------RVE1(2) --------->YAB1
       --------->ANAC46----------->HVH21                      <---------MYB52(1) <---------CCA1(2)--
------->ANAC46  <---------DOF5.7(1) <---------RVE1(2)        <-------GAMYB<---------YAB5       <----
>TOE2(3)<---------RAP2.6(3)     --------->O2   --------->RVE1(2)  <---------AGP1--------->LBD16-----
 
taggccatagccgtcacagtctttctgtcacagccatgtgattttgtgaacatcacatatagaccgttggatctgttgtcatccgtatcatcacatcgga  15765600
            --------->YAB5
            --------->ATHB12
           <---------YAB1
           <---------YAB5
       <---------AHL20(3)                                                <---------WOX13(2)
       <---------AHL12(3)                                                <------------CBF
       <---------AHL20(2)                                           <<<<<<<<<<E2Fc
      <---------ICU4                                                <<<<<<<<<<E2Fb
    --------->AHL12(2)                                              <<<<<<<<<<E2Fd
   --------->AHL12(2)                                               <<<<<<<<<<E2Fe
  --------->AHL25(3)                                                <<<<<<<<<<E2Fa
  --------->AHL25(1)                                               ----------->GT1
  <---------AHL20(2)            --------->DAG2                     --------->LBD16
  --------->AHL20(2)           ---------->DOF2                   --------->LBD16                <---
---->ARR11(2)            --------->DEAR3(1)      --------->DOF5.7(1)<<<<<<<<<<E2Ff            <-----
-----ARR11(2)          --------->YAB5          ---------->DOF2   <---------LBD16              ------
--------->GT1        --------->DEAR3(2)    <---------LBD16     <---------LBD16               <------
-----ARR14(2)>>>>>>>>>ARR1  <---------ANAC46--------->LBD16 --------->DOF5.7(1)              <------
---->ARR14(2)>>>>>>>>>ARR2------>NtERF2   <---------LBD16  --------->DOF5.7(1)        ------->TEIL<-
 
accgtttaatttttatgattgtgaaacgacgacgtaaagttgttaaccgggaaagacgaagaaaaacgcgcgggaaaattgagagactgcatcttaatca  15765700
                                                                 <---------GATA12
                                                                 --------->GATA12
     --------->GLK1(2)                                         <---------AHL12(1)
    <---------RVE1(2)                                          <---------AHL20(2)
    <---------GLK1(2)                                          <---------AHL25(3)
    --------->ARR11(2)           <---------YAB1                --------->AHL12(1)             <-----
    --------->ARR14(2)  <---------YAB1                        --------->AHL25(1)           <-------TEIL
    <---------ARR14(2)*TSS  <-------TEIL                      <---------AHL25(1)     --------->ARR11(2)
<---------TOE1(2)     <---------At4g35610                     --------->AHL25(3)     <---------ARR14(2)
------YAB5           --------->GLK1(2)                        --------->AHL20(2)     <---------ARR11(2)
----ICU4             <---------GATA12                         --------->AHL12(3)     --------->GATA12
--->YAB1             --------->GATA12                  --------->ZAT2                <---------GATA12
---ATHB12     <---------AHL20(2)<---------TOE2(2)      <---------ZAT2<---------TOE2(3) ------>ZmHOX2a(2)
---YAB5   --------------->AGL15 <---------TOE1(2)      --------->At4g35610      <---------ANAC46 <--
--------SPL7(1)     <---------GLK1(2)                  <---------At4g35610      --------->ALFIN1----
 
tcgtagggattctctattttttggaatctgattcatatgtttggggtttaatagtctcagctcaaataaatctaggttaaactgtgtggatcgattcata  15765800
                                              <---------YAB1
                                     <---------AHL25(2)
                                     --------->AHL12(1)
                                     <---------AHL25(1)
                                     --------->AHL25(2)
                                     --------->AHL20(2)
                                     <---------AHL20(2)
                                     <---------AHL20(3)
                                     --------->AHL20(3)
                                     --------->AHL25(1)
                                     <---------AHL25(3)                                       <-----
                                     <---------AHL12(1)                                    <------NtERF2
                                     <---------ICU4                                        ---------
                                    <---------AHL12(2)                                    <---------ATERF1(1)
                                    --------->AHL12(2)                                   <---------DEAR3(1)
                                   --------->AHL20(3)                                   <---------YAB5
                                   --------->AHL25(2)                                   <------NtERF2
                    ------>MYB46(1)<---------AHL25(2)                                 <---------ANAC46
    --------->LBD16 --------->MYB52(1)  <-----------GT1   --------->WOX13(2)          --------->bZIP60(1)
    <-----------HVH21             <---------ICU4         --------->ATHB12             <---------bZIP60(1)
   --------->ANAC46 ------>MYB83 --------->ICU4         <---------YAB1               <------NtERF2
----CCA1(2)       --------->AtMYB61--------->AHL12(2) <----------DOF2              --------->ALFIN1
-------GLK1(2)    <---------MYB59<---------YAB1    <---------ALFIN1           <-----------GT1------>NtERF2
----->KAN1  --------->AtMYB61  --------->YAB1 <---------YAB5                  --------->MYB52(1) ---
 
tattctccgtcaaaaccaaaaccaaaccgatttgtcataattttttcttatcatccactttcattggctagagggacattgtaacggtgtcgtcgtcgcc  15765900
                                                                            <------ZmHOX2a(2)
                                                              <---------GLK1(2)
                                                             <---------At4g35610
                                                       <-----------ARR10   --------->GATA12
                                                    <---------ANAC46       <---------GATA12
                                                    <---------ANAC58       --------->ARR11(3)
                           <----------DOF2          --------->ANAC55(2)    --------->RVE1(2)
                      --------->KAN1                <---------ANAC58       <---------ARR11(3)
                     <---------KAN4(2)          <----------DOF2        <-----------GT1          <---
-NtERF2  <---------DOF5.7(1)                   <---------DOF5.7(1)   <----------DOF2            <---
>ATERF1(1)    ------>ZmHOX2a(1)               <---------DOF5.7(1)   <---------DOF5.7(1)         <---
------>MYB52(1)---------->DOF2             <---------ZAT18   --------->At4g35610  <---------AHL20(2)
 
aaacgatttgcctcttcctaaaggtatgttctttcatttctctcagtgcccctttgcgtatttcagcttcttctttacgatctaattcatttctatgttt  15766000
                                                  <----------DOF2                    <---------AtMYB61
                                                 <---------DOF5.7(1)               <----------DOF2
                                             ------>ZmHOX2a(2)            <---------AHL20(2)
                                            <------ZmHOX2a(2)            <---------AHL25(2)
                                           <---------ARR11(3)            --------->AHL25(2)
                                           --------->RVE1(2)             <---------AHL20(1)
                                    <---------ARR14(2)                   --------->AHL20(1)
                                    <---------ARR11(2)                   --------->AHL20(2)
                       ----------->GT1     --------->ARR11(3)            --------->AHL20(3)
  <---------RVE1(2)  <---------WOX13(2)    <---------GATA12              <---------AHL25(1)
------ANAC58         --------->WOX13(2)    --------->GATA12              --------->AHL25(1)
------ANAC58      --------------->AGL15    --------->AGP1                <---------AHL20(3)
------ANAC46      <---------------AGL15 <---------HSFB2a(2)             <---------KAN1
 
cgtttgattctttgttcaattctgaattgagaaaatggcgattcgagatctatcttttcggtttttcatgtaagaatataatctagctttggtgtttgta  15766100
                                                    <---------MYB59
                                                   --------->ANAC55(2)      <------MYB46(1)
                                                 <---------AHL20(2)         <---------ANAC58
                                                 --------->AHL20(2)         <------MYB83
                                                 <-----------GT1            <---------ANAC58
                                               <---------WOX13(2)          --------->MYB59
                                             --------->AHL20(2)     --------->YAB1            ------
                                             <---------AHL20(2)    <---------YAB5            <------
                ---------->DOF2     <----------DOF2<---------ANAC55(2)<---------YAB1         <------
        <---------ANAC46    <----------DOF2<----------DOF2         <---------YAB1      <---------ANAC58
    <---------ANAC58       <---------DOF5.7(1) --------->WOX13(2)--------->YAB1        <---------ANAC58
    <---------ANAC58  <----------DOF2      --------->TOE2(3)----------->RAV1(1)  <---------YAB1    <
 
ttggtttacttgtgggaagaaaagtctttctctttgggactttaaactttaattacttaactccaacatcatcatagttgggttctgtttgcgagattca  15766200
<- Previous    Next ->

AGI:  At2g37555.1   
Description:  other RNA
Range:  from: 15763800    to: 15765357    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g37560.1   
Description:  ATORC2/ORC2 (ORIGIN RECOGNITION COMPLEX SECOND LARGEST SUBUNIT); DNA replication origin binding / protein binding. Identical to Origin recognition complex subunit 2 (ORC2) [Arabidopsis Thaliana] (GB:Q38899); similar to unnamed protein product [Vitis vinifera] (GB:CAO61324.1); contains InterPro domain Origin recognition complex subunit 2; (InterPro:IPR007220)
Range:  from: 15765723    to: 15768340    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version