AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                --------->ANAC58
                --------->ANAC58
            <------ZmHOX2a(1)
   ------>ZmHOX2a(2)
   ================HOX2a_HOX2a
  =================HOX2a_HOX2a
  <------ZmHOX2a(2)
 <---------GATA12
 <---------ARR11(2)
 <-----------ARR10                                                        <-------GAMYB
 --------->ARR11(2)                             --------->ANAC58          <---------ANAC46
 --------->RVE1(2)                              --------->ANAC46         <---------ANAC58
 --------->ARR14(2)                        <---------At4g35610           <---------ANAC58          -
 --------->GATA12                       <-------TEIL                    <-------TEIL              --
 <---------ARR14(2)          --------->ANAC58   --------->ANAC58        --------->ZAT18           --
<------ZmHOX2a(1)            --------->ANAC58----------->HVH21       --------->KAN1            -----
>GT1      --------->LBD16  ---------->DOF2<---------GATA12 --------->ANAC46               <---------KAN1
 
agaggatccaatccaggacaagaacaacgagaaagcatcgaaatacatctcacgcgaagtataagcgatgagaagtgcgttgtaagagaaggcatttcta  15673900
                                      <------ZmHOX2a(2)
                                <---------ARR14(2)
                                --------->ARR11(2)
                                <---------ARR11(2)
                                --------->ARR14(2)
                               <------NtERF2
                              --------->LBD16
                         <----------DOF2
                        <---------ANAC58
      <---------ANAC46  <---------ANAC58 ------>ZmHOX2a(1)
  <---------WOX13(2)<---------ANAC58 --------->ARR11(3)                                  ===========
-------->At5g28300  <---------ANAC46 <---------ARR14(2)                     <------ZmHOX2a(1)
--------->GT1       <---------ANAC58 --------->ARR14(2)            ----------->HVH21     <----------DOF2
----->GAMYB     <-------MYC3 <---------ANAC46   ----------->GT1    --------->WRKY12  <---------RAP2.6(2)
---->MYB52(1)   ------->MYC3<---------LBD16     <---------ZAT6   <----------DOF2    <---------LBD16-
 
acggtaatttcgtcgaacacatggagtgcttggcggaaacgatcctgcctagtgtaaaaactgatgagctttgacgcgaggaagttgtccggcttgatgg  15674000
                                                                                                  <-
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                ----
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                             -------
                                                                                             -------
                                                                                            --------
                                                                                          <---------SPL7(1)
                                                                                         --------->DEAR3(1)
                                                                                         --------->ETT(2)
                                                                                         <---------ETT(2)
                                                                                         --------->WRKY38(1)
                                                                                         --------->WRKY12
                                                                                        --------->ATERF1(1)
                                                                                        <------NtERF2
                                                                                      --------->DEAR3(1)
                                                                                      --------->RAP2.3(3)
                                                                                      --------->RAP2.3(2)
                                                                                     --------->RAP2.3(1)
                                                                                     --------->RRTF1(1)
                                                                                     --------->ERF1
                                                                                    --------->ABI4(1)
                                                                                    ------>NtERF2---
                                      <------ZmHOX2a(1)                            --------->DEAR3(1)
                                --------->REM1(2)                                  --------->DREB2C(2)
                               --------->ALFIN1                                    <---------ALFIN1-
                              ------->PIF5                                        --------->MYB46(3)
                              ------->MYC2                                        --------->DEAR4(2)
                              <-------PIF5                                        --------->DEAR3(2)
                              <-------MYC2                                       ------->TEIL-------
                              ------->PIF4       <---------O2                    <---------ATERF1(1)
                              ------->MYC3       <---------ANAC58               <---------ALFIN1----
                              <-------MYC4       <---------bZIP60(2)            --------->ANAC46----
                              ------->MYC4       <---------ANAC46              <---------ABI4(2)----
                              <-------PIF4    ----------->TGA1                --------->ANAC58 -----
                             --------->TGA1a  ----------->HVH21               --------->ANAC58<-----
                             <---------O2    <-----------HVH21                --------->ANAC46<-----
                             <---------TGA1a<------MYB46(1)                  --------->SPL7(1)------
                    --------->At4g35610     <---------DEAR3(2)           <---------------AtSPL3-----
              <---------ANAC46<-------MYC3  <------MYB83  --------->ALFIN1 <---------SPL7(1)--------
           <---------LBD16   --------->O2  <---------DEAR3(1)            --------------->AtSPL3-----
       <---------ARR14(2)   ------------>OsbHLH66<---------TGA1a       ------------------>SPL14-----
       --------->ARR14(2)----------------->PIF3(1)    <---------ZAT14 --------->WRKY38(1)-----------
  <----------ID1----------->HVH21 <---------ANAC46<---------MYB46(3)  ----------->HVH21<---------ATERF1(1)
=======================================bZIP_DOF  <---------ANAC58   --------->At4g35610<-----------HVH21
-------->DOF5.7(1)  <---------At4g35610    <---------DREB2C(2)      <---------bZIP60(2)------>NtERF2
 
agaagacgacaatacgcgcgtgaagctgaagcacgtggagaggaagtcggtgacgggtgaagtgctggatgaggtgaccgtacgcaccgccgtcgaccgc  15674100
-----NtERF2
------ALFIN1
----->RAP2.3(3)
----->DREB2C(2)
----->RRTF1(2)
----->RRTF1(3)
---->ATERF1(1)
---->RRTF1(1)
-->DEAR3(1)
-->AtMYB61
->MYB46(3)
--->NtERF2
-------------->AGL15
>GAMYB
----->RAP2.3(2)
----->RAP2.6(2)
----->DEAR3(1)                                                                                  ----
---->DEAR4(2)                                                                                   ----
----ATERF1(1)                        <---------GATA12 --------->RVE1(2)                        <----
----At4g35610                        <---------ARR11(2)                                        <----
--->At4g35610            <-------GAMYB             --------->YAB1         ----------->GT1     ------
---->ERF1              <-------TEIL  <---------ARR14(2)          --------->RVE1(2)   ------------>CBF
->DEAR3(2)--------->ANAC58           --------->ARR11(2)     --------->MYB46(3)    <---------AHL25(3)
---->RAP2.3(1)   <---------AtLEC2    --------->RVE1(2)<-----------ARR10   --------->LBD16   --------
---->ORA47(2)  --------->AtLEC2      --------->GATA12<---------CCA1(2)  <---------LBD16    <--------
>HVH21    --------->ANAC58           --------->ARR14(2)  *TSS  ---------->DOF2    --------->AHL20(2)
 
cgccttgtttagcaagccttgcaaggctcgttgaatttcgaatcccaacttcattcatatctaaccaaaagctaaaccggagaaataaaacaatatgaat  15674200
    ------------>CBF  <---------AHL20(2)
----->ARR11(3)       <---------YAB1
----->AHL20(1)      <---------WOX13(2)                                                *TSS
-----KAN1     ------->GAMYB                                                          <----------DOF2
-------TBP <-----------GT1                                                           <---------DAG2
->TEIL     --------->MYB52(1)               <-----------RAV1(1)                      <---------DOF5.7(1)
->YAB5   --------->AHL20(2)      ---------->DOF2            --------->MYB52(1)    <-----------GT1
-YAB1  <---------WOX13(2)     <----------DOF2          <-----------GT1        <---------GATA12 <----
 
atatagaggcaatttaacgggcttattaatgggccttaaagcccatagtgtcgctgtattacagaacggagttttgaaatcgatttgacttttttagttt  15674300
                    <---------YAB1
                  --------->ATHB51
                <---------AHL12(2)
                --------->AHL25(2)
                <---------AHL25(2)
                --------->AHL12(2)
                <---------AHL20(3)
                --------->AHL20(3)
                --------->AHL12(3)
                <---------AHL12(3)
               -------->ATHB1
               <---------ICU4
               --------->YAB1
               <---------AHL25(3)
              <---------AHL12(1)
              --------->AHL25(2)
              --------->AHL25(1)
              <---------AHL25(2)
              --------->AHL12(1)
              <---------ATHB51
              --------->ICU4 <----------DOF2                                                    <---
              --------->AHL25(3)                                                                ----
              <---------AHL25(1)                                                                ----
              --------->AHL20(2)                    ------>ZmHOX2a(2)                        <------
              <---------AHL20(3)                  <---------ARR11(3)                   --------->MYB52(1)
              <---------AHL20(2)                  --------->ARR11(3)                 <---------MYB52(2)
 <---------ANAC58<---------YAB1                   --------->GATA12         ----------->GT1  <-------
 <---------ANAC58<---------YAB5         <-----------GT1   --------->ZAT14 <-----------------------TaNAC69(2)
---TEIL       --------->AHL20(3)  <-------GAMYB   <---------GATA12<------ZmHOX2a(2)--------->RVE1(2)
 
catgtcttgtctgagaaattattattgtcgagctttcggttataaacagtctcgatcttgctacagtcgatcactgaatcgtgaaatagctaacgagtca  15674400
                                                    --------->GLK1(2)
                                                    --------->GATA12
                                                    --------->ARR14(2)
                                                    <---------ARR14(2)
                                                    <---------GATA12
                                                   <---------GLK1(1)
                                            --------->KAN1
                                           --------->ARR14(2)
                                           <---------ARR11(1)
                                           <---------ARR14(2)
                                           --------->RVE1(2)
                                           <---------ARR11(3)           <-----------TGA1
              <---------ZAT2               --------->ARR11(3)           <-----------HVH21
------At4g35610                           <---------CCA1(2)           <---------YAB5
------->RAV1(2)                         --------->YAB1               <---------ARR14(2)    <--------
----->At4g35610                      <---------GLK1(1)               --------->ARR11(2)    <--------
---YAB5       --------->ZAT2         --------->GLK1(1)               --------->ARR14(2)    <--------
----HVH21--------->CCA1(2)          <---------RVE1(2)  <-----------RAV1(1)   <------ZmHOX2a(1)    <-
 
tctgaagttgagagacgagctcgttctctgagagttttggatatcatatcttcgaaatctggtggagtttcgaatcgtcaggaccattttggtttcgttc  15674500
                      <---------ANAC58
                      <---------ANAC58
                 <---------ANAC58
              --------->ARR11(2)                  --------->ARR14(2)
              <---------GLK1(2)                   --------->ARR11(3)
              --------->ARR14(2)                  <---------ARR14(2)
              <---------ARR11(2)                  <---------RVE1(2)
              <---------GATA12                   ================HOX2a_HOX2a
              --------->GATA12                 <---------TOE1(2)                        --------->ZAT18
    <----------ID1   <------NtERF2            --------->LBD16        <---------------AGL15
 <---------KAN1  <---------ANAC58             <---------LBD16       ----------------->AGL3  --------
-ANAC46       <---------ARR14(2)    --------->ANAC58      ------>ZmHOX2a(2)             <---------ZAT18
-ANAC58      --------->KAN1         --------->ANAC58    --------->ARR11(3)             <---------ANAC58
-ANAC58  --------->MYB52(1)       <-----------RAV1(2)   --------->GATA12               <---------ANAC58
-----ZmHOX2a(1) <-------TEIL    <-----------HVH21<------ZmHOX2a(1)  <-----------------AGL3  <-------
 
aggaatttcgacaaacagattcgtggcgattcagaggtcaggcaatttccgaggattttgatctctcaagaaccaaaaatggagtttcaagcgtgctcga  15674600
                                                                                  ------>ZmHOX2a(2)
                                                                                --------->ARR14(2)
                                                                                <---------ARR11(3)
                                                                                --------->ARR11(3)
                                                                                <---------ARR14(3)
                                                                                <---------GATA12
                                                                                <---------RVE1(2)
                                                                                --------->ARR14(3)
                                                                                <---------ARR14(2)
                                                                              ----------->ARR10
                                                                           <-----------HVH21
                                                                           --------->LBD16
                                                                          <---------O2
                                                                          --------->O2
                                                                          --------->TGA1a
                                                                          <---------TGA1a
                                                                          =======================MYC_MYB
                                                                          <---------ANAC46
                                                                          ==========================
                                                                        ------>NtERF2
             <---------ARR14(2)                                         --------->LBD16
             <---------ARR11(2)                                        --------->ANAC46
             <---------GLK1(2)                                        --------->MYB46(3) <-------GAMYB
    <-----------RAV1(1)                                            --------->KAN1<------ZmHOX2a(2)
    <---------YAB1                                                <---------YAB1--------->GATA12
  --------->KAN1                                                  <---------YAB5--------->AGP1
 <---------ARR14(2)            --------->ANAC58            <---------TOE1(3)<---------MYB52(1)
 --------->ARR14(2)        <-----------HVH21           <---------ANAC58=============MYC_MYB
->HSFB2a(2)  --------->ARR14(2)--------->ANAC58        <---------ANAC58------->GAMYB  <---------ANAC46
--HSFB2a(2) <------ZmHOX2a(1)---------->DOF2          --------->YAB5 --------->At4g35610 <---------ANAC46
 
agaagttatgctggaggattcttcaagctctgtcaagcgagatggatggagtttcgatgcttatggtttatcatccgccgtgagatcttgtgggttgaat  15674700
             <---------ARR14(2)                                                                  ---
             --------->ARR14(2)                         --------->At4g35610                      <--
             <---------ARR11(2)              <------MYB46(1)         <------ZmHOX2a(1)    --------->ZAT14
             --------->ARR11(2)              <------MYB83--------->GATA12                 <---------ZAT14
       --------->ARR11(2)                  --------->ALFIN1        <---------TOE2(3)<---------MYB52(1)
       <---------ARR11(2)               --------->DOF5.7(1)--------->YAB5--------->ARR11(3)     <---
  <----------DOF2                       --------->DAG2  <---------At4g35610      ---------->ID1 <---
=============bZIP_DOF            <---------ANAC46     <-----------RAV1(2)<---------ARR11(3)    -----
 
cgagactttagaaccggttctgggtttcattgtttagcgttgaaaggtgggtttatctcagatgtctacttaggaagttctctggtcgttttgtacagag  15674800
<- Previous    Next ->

AGI:  At2g37310.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT2G29760.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO18068.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 15671879    to: 15674158    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g37320.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT3G24000.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO18069.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 15674287    to: 15675930    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version