AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                   <---------AHL25(2)
                                                   <---------AHL12(3)
                                                   --------->AHL12(3)
                                                   --------->AHL25(1)                          <----
                                                   <---------AHL25(1)                       <-------
------>ATHB51                                      <---------AHL25(3)                      <--------
----->ATHB1                                        <---------AHL20(2)                     --------->AHL20(2)
-------ICU4                                        --------->AHL25(2)                    --------->AHL20(2)
------>ATHB12                                     <---------AHL20(1)                     --------->AHL25(3)
----->ICU4                                        --------->AHL20(2)                     --------->AHL25(1)
------YAB1                                        <---------AHL12(1)                     <---------AHL25(1)
--->YAB5                                          --------->AHL12(1)                     <---------AHL20(2)
--------->AGL15                                   --------->AHL25(3)                   <---------WOX13(2)
----------AGL15                                   <---------AHL20(2)       <---------------AGL15   <
---------->AGL2       ------>MYB46(1)             <---------AHL25(2)       --------------->AGL15   <
-----------AGL3       ------>MYB83                --------->AHL25(2)       <----------DOF2<---------AHL25(3)
---YAB1     ----------->GT1                       --------->AHL25(1)      <-----------------AGL1  --
-----------AGL2   >>>>>>>>>>MYB80         <---------ZAT6                  <-----------------AGL2  <-
 
ttattggatgaagaagagtcaaaccaaatatgaactagagtagtagagttcaatttttttttttgacaacaatgttttctttttctggtcaaataaataa  15238100
                                                                         <---------GATA12
                                                                   --------->RVE1(2)
                                                                   <---------ARR11(3)
                                                                   --------->ARR11(3)
                                                                  --------->CCA1(1)
                                                                  --------->RVE1(1)
                                                                --------->AHL12(3)
                                                                <---------AHL20(3)
                                                                --------->AHL20(3)
                                                              <---------AHL20(2)
                                                              --------->AHL12(3)
                                                              <---------AHL25(1)
                                                              --------->AHL20(2)
                                                              --------->AHL25(1)
                                                              <---------AHL12(3)
                                                          <---------AHL20(3)
                                                          --------->AHL25(2)
                                                          --------->AHL25(1)
                                                          <---------AHL25(3)
                                                          --------->AHL20(3)
                                                          <---------AHL12(3)
                                                          --------->AHL20(2)
                                                          --------->AHL12(3)
                                                        <---------AHL12(2)
                                                        --------->AHL20(3)
<---------DOF5.7(1)                                     <---------AHL12(3)
-------GT1                                              --------->AHL25(2)                <---------AHL20(2)
--AHL12(2)     --------->DOF5.7(1)                      --------->AHL20(1)            --------->AHL12(3)
-AHL12(2)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)      --------->AHL20(2)           --------->AHL25(3)
----------DOF2 <---------TOE2(3)      <---------YAB1    <---------AHL20(3)          <---------CCA1(2)
---------DOF5.7(1)         <---------WOX13(2)           <---------AHL25(2)<------ZmHOX2a(2)
------->TOE2(3)<---------TOE1(3)   <---------ATHB51    --------->AHL12(2)--------->ARR11(3)
--------DOF5.7(1)   ---------->DOF2--------->ICU4      --------->YAB1    <---------ARR11(3) --------
 
accttttttgttcatattaaggtgaaagaaaattagaaattatgaacaaatgttttaaaaataatataaatatctagatcatattgcatatatttcattt  15238200
                                                                         ----------->GT1
                                                                     <---------AHL25(1)
                                                                     <---------AHL20(3)
                                                                     --------->AHL20(3)
                                                                     <---------AHL20(2)
                                                              <---------ICU4
                                                              <---------AHL25(3)
                                                             --------->AHL25(3)
                                                             --------->AHL25(2)
                                                             <---------AHL25(2)
                                                             <---------AHL25(1)
                                                             <---------AHL20(2)
                                                             --------->AHL12(1)
                                                             <---------ATHB51
                                                             <---------AHL12(1)            <--------
                                                             --------->AHL20(2)            ---------
                                              --------->AHL25(1)     --------->AHL20(2)    ---------
                                              <---------AHL20(2)  <---------AHL20(2)      --------->CCA1(1)
                                              --------->AHL20(2)  --------->AHL20(2)      --------->RVE1(1)
              <---------ANAC46                <---------AHL25(1) --------->AHL20(2)      --------->AHL25(2)
         --------->ARR11(3)                   <---------AHL25(3)<---------YAB1           <---------AHL25(2)
         <---------ARR11(3)                  <---------AHL12(2)<---------AHL12(2)       --------->AHL20(3)
       <---------YAB5                       <---------WOX13(2)-------->ATHB1            <---------AHL20(3)
     ---------->DOF2            --------->ARR11(3)           --------->ICU4  ---------->DOF2 >>>>>>>
  --------->YAB5                <---------ARR11(3)           --------->AHL25(1)         --------->AHL12(2)
  --------->YAB1               --------->GLK1(1)             <---------AHL20(3)         <---------AHL12(2)
  --------->TOE2(3)       ---------->DOF2   --------->WOX13(2)<---------AHL12(1)   <----------ID1
->WOX13(2)--------->CCA1(2)    <---------GLK1(1)             --------->AHL20(3)    ----------->GT1
 
accaatgttaaagatttgtgtatatatagaaaagaaatcttcaacaaaattaaactgctaagaaattattaaaaaaatgtaaaagaaggaaaaatatcta  15238300
                                                             <---------WOX13(2)
                                                             --------->WOX13(2)
                                       <---------TOE2(3)    <---------AHL25(3)
                                      ---------->DOF2      --------->AHL25(3)
                                     --------->AHL20(2)    <---------AHL25(3)
                                     <---------AHL20(2)    <---------AHL25(2)
                                   --------->WOX13(2)      --------->AHL20(2)
                                   <---------WOX13(2)      --------->AHL25(2)
                                   <---------AHL12(2)      <---------AHL20(2)                -------
                                  <---------AHL25(3)       --------->AHL12(3)                -------
                                 --------->AHL20(1)        <---------AHL20(1)               --------
                                 --------->AHL20(2)        <---------AHL25(1)              <--------
                                 <---------AHL20(2)        --------->AHL25(1)          <---------At5g28300
                                 <---------AHL20(1)        <---------AHL20(3)         <-----------GT1
                                 --------->AHL12(3)        --------->AHL12(1)      --------->AHL12(2)
                                 <---------AHL20(3)        <---------AHL12(1)      <---------AHL12(2)
                                 <---------AHL25(1)       --------->AHL25(3)      <---------ICU4
                                 --------->AHL25(2)      <---------AHL12(2)       -------->ATHB1
                                 <---------AHL25(2)      <---------WOX13(2)       <---------AHL12(1)
                                 <---------AHL25(3)      --------->WOX13(2)       <---------AHL25(3)
                                 --------->AHL25(3)      --------->AHL12(2)      <---------AHL20(3)
                                 --------->AHL25(1)    <---------AHL20(1)        <---------AHL20(2)
                                 --------->AHL20(3)    --------->AHL20(2)        <---------ATHB51
                                 <---------AHL12(1)    --------->AHL20(3)        --------->AHL20(2)
                                 --------->AHL12(1)    <---------AHL12(1)        --------->AHL20(3)
                                 <---------AHL12(3)    --------->AHL12(1)        --------->AHL25(2)
                                --------->AHL25(3)     --------->AHL20(1)        <---------AHL25(2)
                               --------->AHL12(2)      <---------AHL25(3)        --------->AHL25(3)
                               --------->WOX13(2)      --------->AHL25(3)        --------->AHL12(1)
                             <---------AHL20(2)        <---------AHL20(2)        <---------AHL25(1)
                             --------->AHL25(3)        <---------AHL25(1)        <---------AHL12(1)<
                             --------->AHL25(1)        --------->AHL25(2)        --------->ICU4    <
  ---------->DOF2            --------->AHL20(2)        --------->AHL25(1)        --------->AHL25(1)-
-ARR11(3)                    --------->ICU4           --------->AHL25(3)        --------->WOX13(2) -
>RVE1(2)               <------ZmHOX2a(1)  <----------ID1<---------AHL25(3)      <---------WOX13(2)<-
>ARR11(3)      --------->ANAC58<---------AHL12(2)    <---------WOX13(2)         --------->AHL12(2)--
>>RAP2.2       --------->ANAC58<---------WOX13(2)    --------->WOX13(2)--------->ARR11(2) <---------SPL7(1)
 
aaacatgaagccagagaaacgaaataggagtattaattaattaaagaaacaaactcaattaattaattcaatggaaaccgctaaattattaaccgttcgc  15238400
        --------->AHL20(2)
       <---------AHL12(2)
   <---------AHL25(2)
   <---------AHL12(3)
   --------->AHL20(2)
   <---------AHL25(1)
   --------->AHL12(3)
   --------->AHL25(2)
   <---------AHL25(3)
   --------->AHL25(1)                            --------->AtLEC2
   <---------AHL20(2)                            --------->ANAC58
  <---------AHL20(2)                             --------->ANAC58
  --------->AHL20(2)                        <-----------GT1
  --------->YAB1                        <---------AHL12(3)
--------->WOX13(2)                      <---------AHL20(2)
<---------WOX13(2)                      <---------AHL25(1)
-->ANAC58                               --------->AHL12(3)
-->ANAC58                     --------->AtMYB61  --------->ANAC46
->SPL7(1)                 ---------->DOF2<---------AHL12(2)                             <---------ICU4
-MYB52(1)              --------->TOE2(3)<---------AHL12(1)                        <---------ICU4
---------ICU4          --------->TOE1(3)--------->AHL12(1)                     --------->YAB1
--------HAHB4       --------->ANAC46   --------->AHL25(3)              *TSS    ------->GAMYB
-------->YAB5       <---------ALFIN1   <---------ARR11(3)           ------------>CBF   ------->TEIL
-------->ATHB51   <---------ALFIN1     --------->AHL20(1)      --------->DOF5.7(1)--------->YAB1
--------YAB1      --------->ANAC58     <---------AHL20(1)    --------->DOF5.7(1) --------->ICU4-----
------->ICU4      --------->ANAC58    <---------CCA1(2)      ---------->DOF2  --------->MYB46(3)
 
cataattaaaatttaagagacacacaccttaaacctcacctatatattttccatgcaaaaaaaaaaaagacaacaatttcaaccatcatgaacattacta  15238500
                                                                                           ------->TEIL
                                               <---------YAB1                          <---------TOE2(3)
                                            <---------YAB1                      ------>ZmHOX2a(2)
                    <---------ANAC58    ----------->GT1                       --------->GATA12
                    <---------ANAC58    --------->ANAC55(2)                   <---------AGP1     <--
       <---------TOE1(2)    <---------GLK1(2)<--------HAHB4                   <---------ARR11(3) ---
       <---------TOE2(2)   --------->KAN1   --------->ICU4            <<<<<<<<<TBF1  <---------AHL20(2)
---->ZAT14    <----------DOF2           <---------ANAC55(2)<----------DOF2    <---------RVE1(2)-----
 
aactcactccttggtttcttttctcgtgtctgattcttctatcaggtattattagtctataactttcattttcttcttcttgatctgtttaatgtatgta  15238600
                             <---------AHL25(3)
                            --------->AHL20(2)
                   <---------AHL25(1)
                   <---------AHL20(2)
                   <---------AHL25(3)
                   <---------AHL25(2)
                   <---------AHL12(3)
                  --------->AHL25(1)
                  <---------AHL25(1)
                  <---------AHL20(1)                        <----------DOF2
                  --------->AHL20(2)                  <---------DOF5.7(1)
                  <---------AHL20(2)           <---------AHL25(1)
                  --------->AHL12(3)           --------->AHL20(3)
                  <---------AHL12(1)           --------->AHL25(1)
                  --------->AHL12(1)           <---------AHL20(3)
                  --------->AHL25(2)          --------->AHL25(3)
                  <---------AHL25(2)          --------->AHL25(1)
                  --------->AHL25(3)          <---------AHL12(1)      <---------ANAC58
                 --------->AHL25(3)           --------->AHL12(1)      --------->ANAC55(2)
  --------->RVE1(2)--------->AHL25(2)         --------->AHL20(2)      <---------ANAC58          ----
 <---------CCA1(2)<---------AHL25(3)          <---------AHL20(2)  --------->CCA1(2)             <---
 <---------KAN1 --------->WOX13(2)            <---------AHL25(1)  --------->KAN1        ----------->GT1
-------ANAC46   <---------WOX13(2)         --------->YAB5---------->ID1                <---------TOE2(3)
-------->GT1   --------->WOX13(1)     <-------TEIL   <----------DOF2 <-------TEIL     --------->DAG2
-->TEIL   <---------At5g28300<---------AHL20(2)<---------AHL25(3)<---------RVE1(2)   ---------->DOF2
 
tcgtatatcaaattacagcaattaatttgtattaaatcagtttcatcgattaatttctttttccttttgatatacgtgctagactacataaaggtaaaca  15238700
                                                                <---------ANAC46
                                      <---------DOF5.7(1)       <---------ANAC58                   <
                 --------->ANAC58    <----------DOF2            <---------ANAC58                ----
                 --------->ANAC58    <---------DOF5.7(1) ---------->DOF2                <<<<<<<<<<<<
     <-----------GT1          --------->DOF5.7(1)      ------>MYB46(1)               --------->At4g35610
----->At4g35610<---------ANAC58     <---------ANAC58   ------>MYB83                  <---------At4g35610
------At4g35610<---------ANAC58     <---------ANAC58 --------->TOE1(2)      --------->KAN1      <---
 
gctcaatttctccatctagcgagcaaacacaagaagatggcttttttggtttcaaacctacaaagttgtttgtgttcggagactcgtatgcagacactgg  15238800
                                                                         <---------ZAT14
                                                               -------->P--------->ZAT14
                                                               --------->MYB52(1)
                                                               ------>MYB83
                                                               ------>MYB46(1)
                                                             <---------MYB46(2)
                                                             <---------MYB111(2)
                                                             <---------MYB59 <---------ZAT6
     <----------DOF2         <---------HSFC1(2)      --------->LBD16   <-------GAMYB<---------ANAC58
    <---------DAG2    --------->O2                  <---------LBD16   <---------MYB46(3)        ----
    <---------DOF5.7(1)      --------->HSFC1(2)     --------->LBD16   <---------DEAR3(2)        ----
 <---------ALFIN1     <---------O2                 <---------LBD16   <---------DEAR3(1)  --------->ARR11(2)
---------ALFIN1       <---------ANAC46         <----------DOF2--------->MYB55(1)    <---------ANAC58
----->ARR11(2) --------->KAN4(2)               <---------DAG2<---------MYB111(1)<---------AtMYB61
<<<<<LFY  ------>ZmHOX2a(1)<---------AtMYB61<-----------GT1--------->RVE1(2) <---------YAB5    <----
------ARR11(2)------>ZmHOX2a(2)            <---------YAB5 <---------KAN1<----------DOF2  <---------ARR11(2)
 
aaacacacctttcctgatcgttccctcgtggaggtttcccaatggaatcactttcccgggaatacctaccgggcggtttagtgatggtcgtgtttccact  15238900
                                                                           ----------->GT1
                                                                       <---------AHL20(3)
                                                                       --------->AHL25(2)
                                                 --------->ARR11(3)    <---------AHL20(2)
                                                 <-----------ARR10     <---------AHL25(2)
        --------->SPL7(1)                        <---------ARR14(2)    --------->AHL20(3)
        <-------TEIL             <------MYB83    <---------ARR11(3)   --------->YAB1
      <---------SPL7(1)          <------MYB46(1) --------->ARR14(2)  <---------YAB1
--------->ARR11(3)              --------->MYB46(2)              --------->GATA12
----->YAB1            <---------TOE2(3)  <-----------HVH21      --------->ARR11(3)
----->YAB5           --------->YAB1  --------->GLK1(2)          <---------ARR11(3)              ----
-----ATHB12       --------->YAB1--------->MYB59  --------->RVE1(2) --------->YAB1        ---------->DOF2
 
gattatctcggtacgtttgaactataatgttttgtttggtaatctgtcacaatatctgagtctgtaagatttataatattgtaaacagattgcaaagctc  15239000
<- Previous    Next ->

AGI:  At2g36325.1   
Description:  hydrolase, acting on ester bonds. similar to GDSL-motif lipase/hydrolase family protein [Arabidopsis thaliana] (TAIR:AT5G03610.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15945.1); contains InterPro domain Lipase, GDSL; (InterPro:IPR001087); contains InterPro domain Esterase, SGNH hydrolase-type (InterPro:IPR013830)
Range:  from: 15238472    to: 15240360    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version