AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              ------
                                                                                              ------
                                 <---------At4g35610                                          <-----
                             <-----------HVH21                                                ------
                        <---------WRKY12                                                      ------
                        <---------WRKY38(1)                                 ------>MYB46(1)  <------
                        <---------WRKY45                               --------->ARR11(2)    <------
                --------->CCA1(2)--------->ZAT2                      <---------MYB59         <------
                <----------DOF2  --------->At4g35610            --------->DOF5.7(1)          -------
               --------->GATA12  <---------ZAT2               ---------->DOF2     --------->RVE1(2)
        <---------KAN1 --------->WRKY18(1)                   --------->AHL25(1)   <-----------ARR10
       --------->ARR11(2)   ------->GAMYB                    <---------AHL20(2)   <---------GATA12
       --------->ARR14(2)<---------DOF5.7(2)               <---------WOX13(2)     <---------ARR11(3)
       <---------ARR14(2)--------->MYB52(1)                --------->WOX13(2)     --------->ARR11(3)
   <---------TOE2(3)  <-----------HVH21                  --------->AHL20(2) ------>MYB83--------->ANAC55(2)
  --------->MYB52(1)<---------TOE2(3)                   <---------ATHB12 --------->MYB46(3)------>MYB83
----RVE1(2)    <---------GATA12<---------ZAT18      --------->MYB46(3) <---------ARR11(2)  ------>MYB46(1)
->GT1--------->YAB5 <---------TOE1(3)          --------->YAB1--------->AHL20(2)  <---------GLK1(2)
 
ttttctaacgaatactgagatttaaggtcaacggtgagctcggattagaatcagaaccaatgaattaaagagcctaacctcccaaaatctcacctaatga  14957900
     --------->KAN1
    <---------AHL25(3)                                                         --------->ALFIN1
    <---------AHL25(1)                            --------->ANAC58         --------->DOF5.7(1)
    --------->AHL20(2)                      --------->RVE1(2)            ---------->DOF2
<---------YAB5                       --------->RVE1(2)                --------->ANAC58
--->ATHB12                           <-----------ARR10                --------->ANAC46
--->YAB5           --------->RVE1(2) --------->GLK1(2)                --------->ANAC58
----ICU4       --------->ANAC58      <---------ARR14(2)          <---------ARR14(2)
--->YAB1       --------->ANAC46      --------->GATA12            --------->ARR14(2)
-->HAHB4       --------->ANAC58      <---------GATA12            <---------ARR11(3)
---YAB1        --------->ANAC55(2)  <---------CCA1(2)            <-----------ARR10
---YAB5     <---------ARR11(2)      --------->GLK1(1)        <---------At4g35610
---ATHB12   --------->ARR11(2)  --------->ANAC58  --------->ANAC58--------->CCA1(2)
-->ICU4    --------->DOF5.7(2)  --------->ANAC58---------->DOF2  <---------ARR11(2)
 
ttagacattaattcgtttacgaaatcaaactcagaacgcaaatctaatctctaaagcaatgtgaagcagatataagcaaagagtgtgagtgagatagaga  14958000
                                              <---------MYB46(3)
                                        <<<<<<<<<<<<<<<<<LFY
                  <------ZmHOX2a(1)   --------->ATERF1(1)
               <------ZmHOX2a(1)      <------ZmHOX2a(1)          <------NtERF2
           --------->DOF5.7(1)      --------->ALFIN1            --------->LBD16
         ---------->DOF2         --------->ALFIN1              <---------ANAC46                    -
      --------->HSFB2a(2)      --------->DOF5.7(1)      <---------KAN1                             <
      <---------HSFB2a(2)     --------->DOF5.7(1)<---------MYB46(3)                          -------
      --------------->AGL15 ---------->DOF2  <---------AtMYB61<---------------------WRI1     -------
  <---------ARR11(2)  --------->DOF5.7(1) --------->ATHB12    <---------LBD16                -------
  <---------ARR14(2)---------->DOF2<------ZmHOX2a(1)  ----------->GT1                --------->CCA1(2)
 
gagaggttactggaaagaggaggaaaagagagaaaggaggaggagccattggtgggagagtaaatggcggagaatacatagaaggaagagacgagaacgc  14958100
                   <-----------HVH21
                  ------>ZmHOX2a(2)
                <---------ARR11(3)
                --------->GATA12
                <---------GATA12
                --------->ARR11(2)
                --------->ARR14(2)                                              <---------YAB1
       <-----------HVH21                               <---------ARR11(2)     --------->YAB5
<---------ICU4  <---------ARR11(2)                  --------->ANAC46       <---------ALFIN1
--------->YAB5  <---------ARR14(2)           <---------TOE1(2)       ------>MYB46(1)
--------->YAB1  --------->ARR11(3)     <---------ARR14(2)            ------>MYB83<---------ICU4
-------->ICU4 ----------->ARR10        <---------ARR11(2)            -------->P --------->ICU4
---------ATHB12 <---------RVE1(2)      --------->ARR14(2)           ------>NtERF2--------->KAN1
-->ANAC58  <---------ANAC58            --------->ARR11(2)          --------->DEAR3(1) <---------YAB1
-->ANAC58  <---------ANAC46      <---------ARR11(2)--------->HSFB2a(2)  --------->ANAC46   ---------
-->ANAC46  <---------ANAC58      <---------ARR14(2)<---------HSFB2a(2) ------->GAMYB --------->TOE2(3)
 
caatgatcacagtcgcgtagatcgtcacgaagagaggtttcgaattcgtagcatcgcgaaacccatttcgccaaccctccaccattattctcaatgtttc  14958200
                                                              <----------DOF2
                                                        <---------DOF5.7(1)
                         <---------WOX13(2)            <---------DOF5.7(1)
                         --------->WOX13(2)           <---------DOF5.7(1)                      <----
                   --------->GATA12                   <---------DAG2                          <-----
                   --------->RVE1(2)                ------>NtERF2                            =======
                   <---------GATA12             <-----------RAV1(1)                          =======
                   --------->ARR14(2)         <----------DOF2<---------DOF5.7(1)       <<<<<<<<<TBF1
                  <---------CCA1(2)      --------->KAN1<----------DOF2        ---------->ID1 ------>ZmHOX2a(1)
               ------>ZmHOX2a(1)   --------->DAG2<---------ANAC58      <------------------------ANAC81
>YAB5         --------->TOE2(3)   ---------->DOF2<---------ANAC58--------->KAN1     <<<<<<<<<TBF1
 
aatctcttcttcgtcttcctcaaatctccattaacaaaaaagttttattctttggtgccttttctcttttgttcgggttttgtcttcttcttcttcctct  14958300
                         *TSS
                         <---------ARR14(2)
                         --------->ARR14(2)
                       --------->HSFC1(2)
                       <------MYB46(1)
                       <------MYB83
                       --------->HSFB2a(1)
                       <---------HSFB2a(1)
                      --------->MYB111(1)
                      --------->MYB59
                      --------->MYB46(2)                                       --------->YAB5
                     <--------P                                              <---------TOE2(3)
                   <------MYB46(1)                                          <---------DOF5.7(2)
                  --------->MYB46(2)                                        --------->MYB52(1)
                  --------->MYB111(2)                                    <---------WOX13(2)
                  --------->MYB55(2)                             <---------GLK1(2)
                  --------->MYB59                                <---------ARR14(2)
                  --------->MYB111(1)                            --------->ARR14(2)
                  <---------MYB46(3)                            --------->At4g35610
                  <---------AtMYB61                             <---------ZAT2 --------->ATHB12
                 <---------MYB55(1)                             --------->ZAT2<---------YAB1
                <---------MYB52(1)                              <---------At4g35610
       <---------GATA12<---------HSFC1(2)                       <---------HSFB2a(1)
    <------ZmHOX2a(2)<---------MYB55(1)       ---------->ID1 --------->At4g35610
   --------->GATA12<------MYB83 <---------WRKY38(1)     <----------DOF2  --------->WOX13(2)
------DOF2  <---------RVE1(2)   <---------WRKY45 <------NtERF2  --------->HSFC1(2)
----DOF5.7(1) ------>ZmHOX2a(2)--------->WRKY18(1)<---------DOF5.7(1)   --------->YAB5             -
===========HOX2a_HOX2a<---------TOE1(2)      <---------RAP2.3(1)<---------HSFC1(2)               ---
=====================HOX2a_HOX2a<---------WRKY12------>NtERF2<---------At4g35610<------------CBF----
 
ttgtccgatcgatttgatcgtttggtaggttctggtcaacttcgttttcggcgtcttctctttcagcagcttcgctcattaacgattgtatttgggttac  14958400
        ---------->ID1
  --------->AHL20(3)
  <---------AHL25(1)
  <---------AHL20(2)
  <---------AHL20(3)
  <---------AHL25(3)
 <---------AHL12(1)
 --------->AHL20(2)
 --------->AHL12(1)
 --------->AHL25(1)                                                              <---------YAB1
 <---------AHL25(1)                                                            --------->YAB1
 --------->AHL25(3)                                                           <---------YAB1
 <---------AHL20(2)                                                         --------->YAB1
<---------AHL12(2)                              --------->ANAC55(2)         <---------ICU4
<---------YAB1                                  --------->ANAC58            --------->YAB5
--------->AHL12(2)                              --------->ANAC58           --------->ICU4
-------->AHL12(2)                     <---------ALFIN1                     <---------ATHB12
------>ICU4 <----------DOF2          <---------ALFIN1                 --------->AHL20(2)
----->TOE2(3)                       --------->LBD16  --------->AtLEC2 <---------AHL20(2)
 
attattaatttgtttctttattcaacatttgtttgattccccaactctctcaagtaatgcaaaatagtggcatttaaaatcattataaaacaatgttctt  14958500
                                                               <----------DOF2
                                                       <---------AHL25(2)
                                                       <---------AHL25(1)
                                                       --------->AHL25(2)
                                                       --------->AHL25(1)
                                                       <---------AHL12(3)
                                                       <---------AHL20(2)                   <-------
                                                       --------->AHL12(3)                 --------->YAB5
                                                      <---------AHL20(2)                 <------ZmHOX2a(2)
                                                      --------->AHL25(3)                --------->ARR11(3)
                                                      <---------AHL20(1)                <---------ARR11(3)
                                                      --------->AHL25(2)               <---------GLK1(1)
                                                      <---------AHL25(2)             <------ZmHOX2a(1)
                                                      --------->AHL25(1)         --------->DOF5.7(1)
           --------->At4g35610                        <---------AHL12(1)       ---------->DOF2
           <---------WOX13(2)         --------->RVE1(2)<---------AHL25(3)   <---------HSFB2a(2)
           <---------At4g35610   <---------ANAC46     --------->AHL12(1)    --------->HSFB2a(2)
        <---------MYB52(1)     <---------ANAC46       --------->AHL20(2)<----------DOF2--------->GLK1(1)
 
gttagcaaatggttagctaagtttggacatgttgttgtgtatatcaattcatagcaatttttttttcttttaagactttgtagaaagaggagatcatgaa  14958600
                                                                           --------->AHL20(2)
                                                                           --------->AHL12(3)
                                                                           <---------AHL20(2)
                                                                           <---------AHL12(3)
                                                                           <---------AHL20(3)
                                                                         --------->AHL12(3)
                                                                         --------->AHL25(2)
                                                                         <---------AHL12(2)
                                                                        --------->AHL25(2)
                                                                        <---------AHL20(3)
                                                              --------->DOF5.7(1)
                                                            ---------->DOF2--------->AHL20(3)
                                                  <---------CCA1(1)     --------->AHL20(3)
                                                  <---------RVE1(1)     <---------AHL12(1)
                                                 --------->ARR11(3)     --------->AHL20(1)
                            --------->ANAC46     <---------RVE1(2)      <---------AHL20(1)
                        <-----------GT1          <---------AHL20(1)     <---------AHL25(2)
                      --------->WOX13(2)         --------->AHL20(1)     --------->AHL12(1)
                      <---------WOX13(2)         <---------ARR11(3)    --------->AHL12(2)
                     --------->YAB1            ----------->ARR10  ----------->GT1      <---------MYB46(3)
                     --------->YAB5         <---------RVE1(2) <---------TOE2(3)<---------CCA1(2)
     <---------YAB1  <---------ICU4   --------->DOF5.7(1)  <---------KAN1<---------AHL12(3)      <--
   --------->YAB1   <---------YAB1   --------->AHL20(2)  --------->YAB1--------->ICU4<---------MYB52(1)
--YAB1            --------->YAB1     <---------AHL20(3)<---------TOE2(3)<---------AHL25(3)       ---
 
ttgaaatcacaattggaagacttataattacacttaagaaaaaaatggataagatattaagaataaaggtagtaatatttttatatctgtttgttaatct  14958700
                                                          ---------->DOF2
                                                       --------->ANAC58
                                                       <---------ANAC55(2)
                                                       --------->ANAC58
                                                       --------->ANAC46
                                                 --------->AHL25(1)
                     --------->ATHB12            --------->AHL12(1)               ------>ZmHOX2a(2)
            --------->GATA12                     --------->AHL12(3)              <------ZmHOX2a(2)
      --------->WOX13(2)                         <---------AHL20(2)             --------->AGP1
      <---------WOX13(2)                         --------->AHL20(2)             <---------ARR11(3)
   --------->AHL20(2)<---------AHL20(2)          <---------AHL25(3)             --------->ARR11(3)
 ----------->GT1   --------->AHL12(3)            <---------AHL12(3)             <---------RVE1(2)
 <---------WOX13(2)<---------AHL12(3)            <---------AHL25(1)             <---------GATA12
 <---------ANAC55(2)--------->AHL25(3)           <---------AHL12(1)             --------->GATA12
 --------->ANAC55(2)<---------YAB1 ----------->GT1<---------AHL25(3)           <---------GLK1(1)
--------->MYB59    --------->AHL12(2)            --------->AHL25(2)            --------->GLK1(1)
-------WOX13(2)   --------->AHL12(2)             --------->AHL25(3)   --------->DOF5.7(1)
------>WOX13(2) ------->TEIL   ------->TEIL    <---------AHL12(2)   ---------->DOF2
 
agttaagtaaatttagatgtatatttattgaatgaatttggaaaaacaaaaattaaatacgcaaagacacaaaaagacagagagatcttaatgcaatgct  14958800
<- Previous    Next ->

AGI:  At2g35610.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G70630.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO63742.1); similar to expressed protein [Oryza sativa (japonica cultivar-group)] (GB:ABF97349.1); similar to hypothetical protein OsI_012032 [Oryza sativa (indica cultivar-group)] (GB:EAY90799.1); contains InterPro domain Reticulon; (InterPro:IPR003388)
Range:  from: 14954444    to: 14958326    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version