AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                              <---------ANAC46
                                                                              <---------ANAC58     <
                                    <---------ZAT18                         --------->LBD16        -
                                    --------->ZAT18                         ------>NtERF2         --
--------ANAC55(2)                  <------ZmHOX2a(1)                       <---------DEAR3(1)<------
------->ANAC55(2)             <---------ANAC46                            <---------LBD16    <------
------->ANAC46                <---------ANAC58                    <---------ALFIN1  --------->ANAC46
------->ANAC55(1)      --------->ARR11(3)                    --------->At4g35610   ------->TEIL   --
--KAN1              --------->HSFB2a(2)     <---------ZAT6   <---------At4g35610--------->ALFIN1 <--
->KAN1 <---------MYB46(3)     <---------ANAC58              <---------ARR11(3)<---------ANAC58  ----
 
cacgtatgagttgttgtcttcttagagaacttggcttaggacactcagtgtaaactctctcgagagcttccacttgctccggcgtgtacctcacatactt  14651000
           <---------DAG2
           <----------DOF2
      <-----------GT1
   <---------KAN1
  <---------GATA12
  --------->GATA12
  --------->GLK1(2)                                                                                <
  <-----------ARR10                                                                               --
 <---------GLK1(2)                                                                             <----
<------NtERF2                               <---------At4g35610                              -------
---------RAP2.6(3)   ------>NtERF2          --------->At4g35610                             --------
-------->LBD16      --------->DEAR3(1)<-----------ARR10          <---------ICU4            ---------
------->ETT(1)    --------->LBD16     --------->ARR11(3)         --------->YAB1            ---------
---ANAC58  <---------DOF5.7(1)        <---------ARR11(3)        <---------YAB5         <------ZmHOX2a(1)
---ANAC58 <---------DOF5.7(1)         --------->RVE1(2)         <---------YAB1        ----------->GT1
------->LBD16     <---------ATERF1(1)<---------CCA1(2)        <---------ICU4          <----------ID1
-------LBD16 --------->KAN1        --------->YAB1             --------->YAB1         ----------->GT1
----->MYB52(1)  <---------LBD16   <---------YAB5      <---------KAN1     ---------->DOF2  --------->DOF5.7(1)
 
gccggaatctaaccctttatccggcgactctctgttcatcatatctctgctcatcgaatggaccatcatcatagctcaaagtcagaaataggaaaaaagg  14651100
--------->GLK1(2)
---------GLK1(2)
------->YAB5                             <---------TOE2(2)
--ZmHOX2a(1)                             <---------TOE1(2)
-->DOF5.7(1)                      --------->GLK1(1)
->DOF5.7(1)                       --------->KAN1           <------MYB46(1)                         -
>DOF5.7(1)     ---------->DOF2    <---------GLK1(1)        <------MYB83            <---------ALFIN1<
->DOF2<---------YAB1 ----------->GT1    --------->STY1(1)<--------P  <---------REM1(2)      <-------TEIL
 
acgattcttttgaatgggtaaagcttgaaaattggagaaatccctaggttattttcaagggtaggctctctctactcagagagcctccactcacgttcat  14651200
                                                                         <-----------GT1
                                                                      <---------AHL20(3)
                                                                      <---------AHL25(1)
                                                                      <---------AHL20(2)
                                                                      --------->AHL20(3)
                                                                  <---------AHL20(2)
                                                                 --------->AHL25(3)
                                                                <---------AHL12(3)
                                                                --------->AHL12(3)
                --------->DAG2                                  --------->AHL20(3)
               --------->DOF5.7(1)                              <---------AHL20(2)
               ---------->DOF2    ------------------------>ANAC81<---------YAB1
              --------->DOF5.7(1)<----------ID1                 <---------AHL25(2)                 X
        ----------->GT1       ---------->DOF2        --------->DAG2   --------->AHL12(3)         ---
-------->ARR11(3)--------->DOF5.7(1)                ---------->DOF2 --------->AHL12(2)           <--
---------RVE1(2)--------->DOF5.7(1)     --------->AHL20(2)      <---------AHL20(3)           <------
 
gagataatggtgagaaaaaaaaggagttttggagaaagaacaaataaacaaaaaaaaaagtttctatttttatttttttcggtttatttgttatttcttt  14651300
               <-----------RAV1(2)
            --------->ANAC46                                                    --------->ANAC58
            --------->ANAC58                                               --------->DAG2
  --------->ANAC58                                                       --------->CCA1(2)  --------
  --------->ANAC58          <---------ANAC58                      ------------------------>ANAC81
XXXXXXXXXXXXXXXXXXX>MIR390A/B            <------ZmHOX2a(1)   --------->DOF5.7(1)--------->ANAC58
------>At4g35610            <---------ANAC46       *TSS    --------->CCA1(2)<---------TOE2(3)  <----
-------At4g35610     --------->ZAT18<------ZmHOX2a(1)    --------->CCA1(2)---------->DOF2   <-------
----DOF2    --------->ANAC58<---------ANAC58 <------ZmHOX2a(1)   <------ZmHOX2a(1) ---------->DOF2
 
agctcaagacagaaaacgccagagggcaatggcgagagaggagaggaaggagaagcgaagagataagaggagcaagataaaggaagcaaagtagaggtct  14651400
                     ------>ZmHOX2a(2)
                   --------->AGP1
                   --------->ARR11(2)
                   <---------ARR11(2)
                   --------->ARR11(3)
                   --------->ARR14(2)
                   <---------ARR14(2)
                   <---------ARR11(3)                    --------->ZAT6                   <------NtERF2
                   --------->GATA12                 --------->YAB1                       ------>NtERF2
                   <---------GATA12             <---------AHL25(3)                      <---------ANAC58
        ------------>CBF                        --------->AHL20(2)                   <---------DEAR3(1)
       ------>NtERF2<------ZmHOX2a(2)        <---------AHL12(2)                    <---------ANAC58
      --------->ANAC58                     --------->AHL20(2)                      <-----------RAV1(1)
      --------->ANAC58 <----------DOF2     --------->AHL12(3)                      <---------ANAC58
      --------->ANAC46 ------>ZmHOX2a(1)   --------->AHL25(1)                    <---------ANAC46
      --------->RAP2.6(2)                  <---------AHL12(3)            <----------DOF2<---------ANAC46
->ARR11(3)        <---------GLK1(1)        --------->AHL25(2)            <---------DAG2 <---------ANAC58
------DOF2 <---------ARR14(2)              --------->AHL20(3)         <-----------GT1--------->ALFIN1
--ARR11(3) <---------GATA12                <---------AHL20(3) ---------->DOF2 <----------DOF2 ------
 
ttatctcagacgccaatctcgagatccttttaagacatggtccaaaaaaaataaaacataactctaaaagaaattacttttcttttgtgtggcgcgagaa  14651500
                                                             <---------ANAC46
                                                             <-------GAMYB
                                                            <------MYB46(1)
                                                            <------MYB83
                                                           <---------MYB46(3)
                                                          --------->ALFIN1
                                                          <--------P
                                                        =========================================bZIP_DOF
                                                        =============MYC_MYB
                                                        <---------ZAT2
                                                        <---------TGA1a
                                   --------->AHL20(2)   --------->ZAT2
                                   --------->AHL25(2)   <---------O2
                                   <---------AHL25(1)   --------->O2                       <--------
                                   <---------AHL12(3)   =============================bZIP_DOF
                                   <---------AHL25(2)   --------->TGA1a                    <--------
                          ----------->GT1             <-----------RAV1(2)                 <---------At5g28300
                         <---------TOE2(3)         --------->ANAC46                   <----------DOF2
                        --------->DAG2             --------->ANAC58                <-----------GT1
                       ---------->DOF2             --------->ANAC58            <----------DOF2  ----
                       ===========================================bZIP_DOF---------->DOF2<----------
---->DOF2             <---------KAN1--------->DOF5.7(1) ==================================bZIP_DOF--
 
agacttgcaagaacataaaaacagcataaaggtaaaaaaaaaatgaaaactgaaacgccaggtgggttgaatttgataaaagctttttacttttacggtt  14651600
                       <---------ARR11(3)
                       --------->ARR11(3)
                    <---------AHL25(3)
                    --------->AHL20(3)
                    --------->AHL12(3)
                    <---------AHL12(3)
                    <---------AHL20(3)
                    <---------AHL12(2)
                    <---------AHL25(1)
                   <---------AHL20(2)
                   --------->AHL20(2)
                   --------->AHL25(1)
                   --------->AHL25(3)
                   <---------AHL25(3)
                  <---------AHL20(3)
                  --------->AHL20(3)
                  --------->AHL25(3)
                  <---------AHL20(2)
                  --------->AHL20(2)            <---------AHL20(2)
                 <---------AHL12(2)            <---------AHL12(2)
                 --------->AHL12(2)           <---------AHL12(2)
                 --------->WOX13(2)           --------->AHL12(2)
               <---------AHL25(2)            --------->AHL12(1)
               --------->AHL25(1)            --------->AHL20(2)
               <---------AHL25(1)            <--------ATHB1
               --------->AHL25(2)            --------->ATHB51
               <---------AHL12(1)            --------->AHL20(3)
               <---------AHL20(3)            <---------ICU4
               --------->AHL20(1)            <---------AHL20(2)
               --------->AHL20(3)            <---------AHL25(2)
               --------->AHL25(3)            <---------AHL25(3)
               --------->AHL12(1)            <---------AHL20(3)
               <---------AHL25(3)            <---------AHL12(1)
               <---------AHL20(1)            --------->AHL25(2)
               <---------AHL12(3)            --------->AHL25(1)
               <---------AHL20(2)            <---------AHL25(1)
               --------->AHL20(2)           --------->ICU4
              <---------AHL12(1)            <---------YAB1
              --------->AHL12(1)            --------->AHL25(3)
              --------->AHL25(3)           <---------AHL25(2)
              --------->AHL20(2)           --------->AHL25(2)
              <---------AHL20(2)           <---------AHL20(3)
              --------->AHL12(3)           --------->AHL20(3)
              <---------AHL12(3)           --------->AHL12(2)
 <---------AHL20(2)<---------AHL25(1)     --------->YAB1
 <-----------GT1 <---------WOX13(2)    --------->YAB1
-TOE1(3)      --------->AHL25(1)   --------->RVE1(2)
-TOE2(3)    --------->YAB1         <---------GATA12<-----------GT1                <---------ZAT18
----->AHL25(3)<---------AHL25(1)   <---------ARR11(3)                             --------->ZAT18  <
-GT1  --------->RVE1(2)--------->RVE1(2) <---------YAB1          --------->ARR14(2)             <---
------->WOX13(2)<---------AHL12(2) --------->ARR11(3) <----------DOF2             <---------ZAT14  -
 
ttatttacatagctaaaataaattaatatctactgcaaaatctcataataatttatactttgtgtccatatttgtactcaatgtgttcactaaaaacatt  14651700
                                                                                   <---------ICU4
                                                                                   <-----------GT1
                                                                                 --------->WOX13(2)
                                                                                 <---------WOX13(2)
                                                                           <---------ZAT18
                                                                           --------->ZAT14
                                                 ---------->DOF2           <---------ZAT14
                                            ----------->GT1                --------->ZAT18
       ---------->DOF2                  <---------AHL12(3)               --------------->AtSPL8
  ----------->GT1                       <---------AHL25(2)               <---------------AtSPL8
----------DOF2                          <---------AHL25(1)              <---------ANAC46
------AHL20(2) --------->ICU4           --------->AHL20(2)   <---------WOX13(2) <---------ICU4
-------->TOE2(3)--------->ATHB12        --------->AHL25(2)   --------->WOX13(2)--------->ICU4
 
tactttagtaaaaagaaaatgatttgtccaaaaaaaaaaaaaaaaaaatgtaaaaagaaaatgcaattgagttttatgtgtactaattactacataagtt  14651800
                                    <---------AHL25(3)
                                    --------->AHL12(1)
                                    <---------AHL12(1)
                                    --------->KAN1
                                   <---------AHL12(2)
                                   --------->AHL25(3)
                                   --------->AHL12(3)
                                   --------->AHL25(2)
                                   <---------AHL25(1)
                                   --------->AHL25(1)
                                   <---------AHL25(2)
                                   --------->AHL12(1)
                                   <---------AHL12(1)
                                  <---------AHL25(2)
                                  --------->AHL12(2)
                                  --------->AHL25(2)
                                  <---------AHL20(3)
                                  --------->AHL12(3)
                                  --------->AHL20(3)
                                 <---------AHL12(2)
                                --------->AHL20(2)
                                <---------AHL12(3)
                                --------->AHL12(3)
                                <---------AHL25(3)
                                <---------AHL20(2)
                                --------->AHL25(2)                                    --------->DOF5.7(1)
                                --------->AHL20(3)                           <---------AHL12(2)
                                --------->AHL25(1)                           <---------WOX13(2)
                                <---------AHL20(3)                           --------->WOX13(2)
                               --------->AHL12(3)                           <---------ICU4
                               <---------AHL20(1)                          <---------AHL12(1)
                               --------->AHL20(2)                          --------->AHL20(2)
                               <---------AHL12(3)                          --------->AHL25(3)
                               --------->AHL20(1)                          --------->AHL12(1)
                               <---------AHL20(2)                          <---------AHL25(1)
                               --------->AHL25(1)                          <---------ATHB51<--------
                               <---------AHL25(3)                          --------->ICU4--------->ALFIN1
                               --------->AHL25(3)                          --------->AHL25(1)
                               <---------AHL25(2)                 --------->At4g35610 --------->DAG2
                               <---------AHL25(1)             <---------AHL12(2)<---------AHL25(3)
                               --------->AHL25(2)           --------->AHL12(1)  --------->AHL25(1)
                          --------->AHL20(3)                <---------AHL12(1)  <---------AHL20(2)
                          --------->AHL20(1)                --------->AHL25(2)  <---------AHL20(3)
                          <---------AHL12(3)                <---------AHL25(1)  --------->AHL20(3)
                          <---------AHL20(3)                --------->AHL25(1)  <---------AHL12(3)
                          <---------AHL20(2)                <---------AHL20(3)  --------->AHL25(2)
                          --------->AHL25(2)                <---------AHL20(2)  --------->AHL20(2)
                          --------->AHL25(1)                --------->AHL20(2)  <---------AHL25(1)
                          <---------AHL25(3)                --------->AHL20(3) <---------AHL20(2)
                          --------->AHL25(3)                <---------AHL25(2) --------->AHL20(2)
                          <---------AHL25(2)                --------->AHL25(3) --------->YAB1
                       --------->YAB1 <---------YAB1      <---------AHL12(2)<---------AHL25(3)
          <---------ANAC58<---------AHL25(1)              --------->AHL12(2)--------->YAB5<-------TEIL
          <---------ANAC58--------->AHL20(2)             --------->YAB1    <---------AHL12(3) <-----
  ----------->GT1--------->AtLEC2--------->AHL12(2)      --------->AHL20(2)<---------AHL20(2) ------
 
tcttctggttataacttgtgatgcaaaaataaaataaaattattctagtatttgtagcaataaaaaattagctaagaaataattaaaataaggtgcagga  14651900
<- Previous    Next ->

AGI:  At2g34710.1   
Description:  PHB (PHABULOSA); DNA binding / transcription factor. similar to PHV (PHAVOLUTA), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT1G30490.1); similar to REV (REVOLUTA), DNA binding / lipid binding / transcription factor [Arabidopsis thaliana] (TAIR:AT5G60690.1); similar to ATHB-8 (HOMEOBOX GENE 8), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT4G32880.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN73584.1); similar to class III HD-Zip protein 3 [Populus trichocarpa] (GB:AAX19052.1); similar to class III HD-Zip protein 4 [Populus trichocarpa] (GB:AAX19053.1); contains InterPro domain MEKHLA (In
Range:  from: 14646402    to: 14651352    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version