AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->ICU4
              --------->O2  <---------YAB5                                                 <--------
              --------->TGA1a                                                             <-------TEIL
              <---------O2--------->YAB1                                <-----------GT1<---------DEAR3(2)
        <-----------GT1--------->YAB5                         <---------TOE2(3)       <---------DEAR3(1)
 <-----------GT1   --------->MYB46(3)                         <---------RVE1(2)    ----------->HVH21
------->WOX13(2)----------->HVH21                       <---------RVE1(2) --------->ANAC55(2)
--->TOE2(3)   <---------TGA1a--------->YAB1             --------->ARR11(3)<---------ANAC55(2)   ----
--->TOE1(3) --------->ANAC46<---------YAB1        --------->ARR11(3)<---------TOE2(3)--------->SPL7(1)
 
tcatttacattttacacacatgaccaccattatcatgctcaatctatgtataatatgttgatattgatgttgatgttacataccttgggacggtgcatga  14396900
                                                                                           ---------
                                                                                          <---------YAB5
                                                                                 ------->PIF4
                                                                                 <-------MYC3
                                                                                 ------->MYC2
                                                                                 <-------MYC2
                                                                                 ------->MYC3
                                                                                 <-------PIF5
                                                                                 ------->PIF5
                                                                                 <-------PIF4
                                           --------->ARR14(2)                    ------->MYC4
                                           <---------ARR14(2)                   <---------O2
                                         <------NtERF2                          --------->O2
                                        --------->RAP2.6(2)                     --------->TGA1a
                                      --------->At4g35610                       <---------ANAC46
                                      <------NtERF2                             <---------TGA1a
                                     <---------DEAR3(2)                        ------------>OsbHLH66
                                    --------->ETT(2)                         <---------ZAT18
                                    <---------DEAR3(1)                       --------->ZAT18
                                    <---------RAP2.6(2)                   --------->DOF5.7(1)
                                  <-----------HVH21--------->KAN1       ==================bZIP_DOF
    ------>NtERF2         <---------MYB52(1)<---------KAN1              ---------->DOF2  ------->TEIL
-AtLEC2             <------ZmHOX2a(1)<---------SPL7(1)          --------->DEAR3(1)--------->ALFIN1
--->TEIL          <---------TOE2(3)--------->RAP2.6(3)        <---------At5g28300<-------MYC4     --
 
atcaggctgccaagagtacttaaggaactgtttgtctggtcggccgaatttgagacagtcgaactcaccgtcgatgaaagggcacgtggatgaatcgtag  14397000
                                                                                                  --
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                               -----
                                                 ==========================bZIP_DOF           ------
                                                 --------->TGA1a                        ------>ZmHOX2a(1)
                                             <---------ALFIN1          <---------ARR11(3)<---------DOF5.7(1)
        <---------HSFC1(2)                   --------->AtMYB61  <----------DOF2      ------>ZmHOX2a(1)
        --------->HSFC1(2)                  --------->MYB46(3) <---------DOF5.7(1)  <---------ALFIN1
----------->GT1                     --------->ANAC58        ------>ZmHOX2a(1)     ------>ZmHOX2a(1)<
-->GT1  <---------HSFB2a(1)         ----------->GT1   <---------At4g35610   <----------DOF2 <-------
------->DOF5.7(1)                   --------->ANAC58  --------->At4g35610  <---------DOF5.7(1)------
 
aaagggtaagaagcatcgaaaacccatctcccttgaaacaagttacaaccactcgtctgcttcctccctttcaacatctcttttcctcctcctcttccgg  14397100
                                                                        --------->LBD16
                                                                      <---------LBD16
                                                                      <------NtERF2
                                                                     ------>NtERF2
    --------->At4g35610                                             <---------ARR14(2)
    <---------At4g35610                                             <---------ARR11(2)
 --------->ATERF1(1)                                                --------->ARR14(2)
 --------->At4g35610                                                --------->ARR11(2)
 <---------At4g35610                                               --------->At4g35610
------>NtERF2                                                    --------->ETT(1)
<---------RAP2.3(1)                                             <---------ORA47(1)
<---------ATERF1(1)                                           <------MYB83
------->ATERF1(1)                  ------->MYC3               <------MYB46(1)
-----NtERF2                        <-------MYC3              <---------AtMYB61
-------ATERF1(1)        <---------MYB52(1)         --------->ANAC58<---------At4g35610
--->NtERF2             ===================MYC_MYB  --------->ANAC58--------->ATERF1(1)
----->DEAR3(1)         <-------GAMYB              --------->SPL7(1)<------NtERF2
------->HVH21         <---------ANAC58          <---------SPL7(1)<---------DEAR3(1)
------DEAR3(1)        <---------ANAC46         <---------ANAC46<-----------HVH21
---->ATERF1(1)        <---------ANAC58    <---------ANAC58 <---------ANAC58
--->LBD16     <---------MYB52(1)<---------TGA1a<---------ANAC55(2)<---------ATERF1(1)
---------DEAR3(1)<-----------RAV1(1)      <---------ANAC58 <---------ANAC58    <---------GLK1(2)
--LBD16      <---------DOF5.7(1)--------->TGA1a--------->bZIP60(1)<---------RAP2.3(1)
>NtERF2--------->MYB52(1)<---------DEAR3(1)    --------->ANAC55(2)<---------DEAR3(2)              --
 
cgacggctgctaacgccgttttgttgcgttggctcacatgtggtttcttgacgtaagccaaggcttggtcggctccggacaagattgtgagtatgagaag  14397200
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                           <----------DOF2                 <--------
                                                        <-----------GT1                    ---------
            --------->DOF5.7(1)                    --------->AHL12(2)                      <--------
          ---------->DOF2                        <---------DOF5.7(1)                      --------->KAN1
--------->DOF5.7(1)                           ----------->GT1                           <---------WOX13(1)
-------->DOF2                              --------->MYB52(1)                    <----------DOF2
 
cgaaagaagaaggaaaagagagttgagtttgaaacccatcttccaagaacggttttttttttcttttctcttaacttgaataggctttgtgatggattcg  14397300
                                                                                   <---------GLK1(1)
                                                                                   --------->GLK1(1)
                                                                                 <------ZmHOX2a(1)
                                                                           --------->YAB5
                                                                           --------->ATHB12
                                                                        --------->WOX13(1)
                                                                       --------->YAB5
                                                                      <---------YAB1
                                                                     --------->ARR11(3)
                                                                    --------->RVE1(1)
                                                                    --------->CCA1(1)
                                                                   <---------AHL12(1)             <-
                             <---------ARR11(3)                    --------->AHL12(1)        <------
--------->AHL20(2)       --------->REM1(2)                 ----------->GT1 --------->YAB1    <------
>ARR14(2)                <---------ZAT14--------------->AGL15     --------->AHL12(3)--------->RVE1(2)
-ARR14(2)             <---------ZAT6   <-----------------AGL3     <---------AHL20(3)--------->GATA12
-GATA12<-------TEIL   <---------ANAC46 =============================================================
-RVE1(2)*TSS    --------->DAG2        ---------->ID1   <---------DAG2<---------ARR11(3)      -------
>ARR11(2)      ---------->DOF2  <----------DOF2    <-------TEIL   --------->AHL20(3)<---------GATA12
-ARR11(2)  <---------TOE2(2) --------->ARR11(3)    ------------>CBF--------->AHL25(2)      ---------
 
agtttatatatacataggtaaagtagtgtgaagagcttcttggccttatatgggttcaatttttgttaaaaatatcattcattaggaaatccaagaatat  14397400
                                                                                     <---------YAB1
                                                                                    <----------DOF2
                                                                                   <---------ICU4
                                                                                   --------->YAB5
                                                                                  <---------YAB5
                                                                               <---------AHL20(2)
                                                                               --------->AHL12(1)
                                                                               <---------AHL12(1)
                                                                               --------->AHL20(2)
                                                                               --------->AHL25(1)
                                                                               <---------AHL25(3)
                                                                               <---------AHL25(1)
                                                                              --------->AHL20(2)
                                                                              --------->AHL12(3)
                                                                              --------->AHL20(3)
                                                                              <---------AHL25(1)
                                                                              --------->AHL25(3)
                                                                              <---------AHL20(3)
                                                                             --------->WOX13(2)
                                                                             <---------AHL12(2)
                                                                             --------->AHL12(2)
                                                                            <---------AHL12(2)
                                                                           <---------AHL12(1)
                                                                           --------->AHL20(3)
                                                                           <---------AHL12(3)
                                                                           <---------AHL20(2)
                                                                           --------->AHL20(2)
                                                                           --------->AHL25(1)
                                                                           <---------AHL25(1)
                                                                           <---------AHL25(3)
                                                                           --------->AHL25(3)
                                                                           <---------AHL25(2)     <-
                                                                           --------->AHL25(2)     <-
                                                                           <---------AHL20(3)    <--
                                                                           --------->AHL20(1)    ---
                        --------->YAB1                                     <---------AHL20(1)    ---
                        <-----------GT1                                    --------->AHL12(1)    <--
                     --------->WOX13(2)                                   <---------AHL12(1)     <--
                   ------>ZmHOX2a(1)                                      --------->AHL12(1)     <--
                  --------->TOE2(3)                                       --------->AHL25(3)     ---
               --------->ARR14(2)                <---------AHL25(3)       <---------AHL25(1)     <--
               <---------ARR11(2)                <---------AHL20(2)       --------->AHL20(2)     ---
               --------->ARR11(2)               --------->AHL25(3)        <---------AHL12(3)     ---
            <---------TOE1(3)                   --------->AHL20(2)        --------->AHL25(1)    ----
     ----------------->AGL2                     <---------AHL20(2)        --------->AHL12(3)   <----
     <-----------------AGL3                     --------->AHL25(1)       --------->AHL12(2)   <-----
     ----------------->AGL3                     <---------AHL12(3)       <---------AHL12(2)   ------
     <-----------------AGL2                     <---------AHL25(3)      <---------AHL12(2)    <-----
--------TOE2(3)<---------ARR14(2)               <---------AHL25(1)   <---------AHL12(2)      <------
---AHL12(1) <---------TOE2(3)                 --------->WOX13(2)     --------->AHL12(2)      -------
---KAN1   <-----------GT1 <---------YAB1      <---------WOX13(2)    --------->AHL20(2)       -------
=======================MADS_MADS         --------->AtLEC2           <---------AHL25(3)     >>>>>>>>>GATA-1
-->AHL12(1)<---------At5g28300           ----------->GT1      ----------->GT1<---------WOX13(2)<----
>YAB1<-----------------AGL1          <------ZmHOX2a(1)   ------>ZmHOX2a(1)<---------AHL20(2) -------
 
ttaggctgtccatttacggttcctaaataacaattgtttaggacatgtaaattaaatgtcctaaatagaaataaaaaataaattaatctttatagataaa  14397500
       --------->AHL12(3)
       --------->AHL12(1)
       <---------ICU4
       <---------AHL12(1)
      --------->ICU4
 ----------->GT1
<---------TOE2(3)
--------AHL20(2)
--------AHL25(3)
-------AHL25(1)
------>AHL25(1)
------>AHL25(2)
-------AHL25(2)
-------AHL20(2)
-------AHL25(3)
------>AHL25(3)
-------AHL20(3)
------>AHL20(2)
------>AHL20(1)                             --------->ARR14(2)
----->AHL12(2)                              <---------GATA12
-----WOX13(2)                               --------->GATA12
----AHL12(3)                                <---------ARR14(2)
--->AHL20(3)                         ------>ZmHOX2a(2)
----AHL20(3)                       <---------RVE1(2)                         <---------ICU4
---AHL12(1)                        --------->ARR11(3)                     --------->YAB1
-->AHL25(3)                        <---------ARR11(3)                    <---------ATHB12         --
-->AHL20(2)                      <---------YAB1                <----------DOF2  <---------WRKY18(1)<
-----AHL12(2)   ----------->GT1--------->YAB5       --------->ATHB12     <---------YAB5           <-
-->AHL12(1)   ---------->DOF2  --------->YAB1    <---------AtLEC2      --------->WOX13(1)      <----
 
tttaatgtaaaaatttctaaagtaaaatactgtatgatgatcttctaaatctgcatgatttctatacttttggacaatcatcttgaccatctattttggt  14397600
                                                                  <----------DOF2
                                                               <-----------GT1
                                                           <----------DOF2
                        --------->LBD16                   <---------DOF5.7(1)
          --------->ANAC55(2)                             <---------DAG2
         <---------HSFB2a(2)      --------->GLK1(2)  <---------ANAC58
------->GATA12      --------->ARR11(2)               <---------ANAC58
---------GLK1(1)    <---------ARR11(2)               --------->YAB1     --------->ANAC46
--------GATA12     <---------GLK1(1)     <---------AHL20(2)<---------DOF5.7(1)                    <-
----P    --------->HSFB2a(2)    --------->KAN1      <---------ATHB12   --------->LBD16        ------
 
agatttctggttctcgtaatacatttccgaagttgaaattctattttttgatgcaatcgtgccttttcactttccacaaaatggttttgaccaaaatgaa  14397700
                                                --------->DOF5.7(1)
                                             <---------------AGL15
                                             --------------->AGL15
                                            <-----------------AGL2
                                            <-----------------AGL3
                                     <---------AHL12(1)
                                    <---------RVE1(1)                                        <------
                                    <---------CCA1(1)                                       --------
                                   <---------ARR11(3)                                       <-------
                                   --------->ARR11(3)                                       --------
                                   <---------GLK1(2)                                       <--------
                          <<<<<<<<<CBP60g  --------->WOX13(2)                              ---------
                          <<<<<<<<<SARD1   <---------WOX13(2)                           <---------LBD16
                         ------>MYB46(1)  <-----------GT1                             --------->ARR11(2)
  --------->KAN1         ------>MYB83--------->AHL12(1)        --------->ZAT18        <---------ARR11(2)
 --------->AHL25(3)    <---------MYB59 <---------AHL12(2) ---------->DOF2             ------->TEIL
-----ZmHOX2a(1)   --------->YAB1   <---------RVE1(2)   <------ZmHOX2a(2)   --------->YAB5 --------->LBD16
---->DOF2   --------->ANAC46      <---------RVE1(1)   <---------GATA12------->GAMYB <-------TEIL
 
aggatttattccttcactcaaacataccaaatttcagagattttttaactaaaaatggatcaaaagttcacaactgcatcactaaaatgcatccggtaac  14397800
<- Previous    Next ->

AGI:  At2g34070.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G29050.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48076.1); contains InterPro domain Protein of unknown function DUF231, plant (InterPro:IPR004253)
Range:  from: 14394500    to: 14397309    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version