AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                           --------->WOX13(1)
                        --------->ANAC58
                        --------->ANAC58
           --------->TOE2(3)                   --------->ARR11(3)
           --------------->AGL15    --------->LBD16
           <---------------AGL15   --------->ANAC58
          ----------------->AGL1   --------->ANAC58
  ------>MYB46(1)      --------->DAG2          <---------GATA12               <---------ARR11(3)
  ------>MYB83        ---------->DOF2          <---------ARR11(3)           --------->ANAC58
 --------->WOX13(1)   --------->DOF5.7(1)    ----------->ARR10              --------->ANAC58      <-
---------GT1     --------->YAB1    --------->ANAC46                    --------->ANAC58         ----
---->RVE1(2)------>ZmHOX2a(1)    --------->AtLEC2   <-----------GT1    --------->ANAC58      <------
 
tcaccaatctacttcctcattcagaaaaagcaatccatgcgcaaaacgaagattttaacaagaggtttatgaacaagacaagctctgcaatttgaataac  13758600
                      <---------MYB52(1)
                   <-------TEIL
                <---------ZAT2                                                       ------>MYB83
                --------->ZAT2                      --------->YAB1                   ------>MYB46(1)
           --------->ANAC46                 <---------DAG2                       ------->TEIL     --
   <---------YAB1<---------GLK1(2)          <----------DOF2                  --------->DAG2     ----
--------ICU4    <---------At4g35610   --------->ANAC58                       <---------------AtSPL3
----->TOE2(3)   --------->At4g35610   --------->ANAC58                      ---------->DOF2   <-----
-----GT1 <-----------GT1              --------->ANAC46--------->ICU4     --------->ANAC46    ------>NtERF2
 
ctcattactattaaaccccagcttcgttggggcattttcacaagcaacttttcagacataattcaaattgcagtttacgaaaagtacctcccatggtgcc  13758700
                                                                                               -----
                                                                                               -----
                                                                                           ---------
                                                                                           <--------
                                                                                         -----------
                                                                                        <------NtERF2
            --------->ICU4                                                             <---------ATERF1(1)
        <---------ZAT14                                --------->KAN1                  <---------RAP2.6(3)
      --------->ANAC46                                <---------RVE1(2)                <------NtERF2
 --------->GATA12                                     --------->ARR14(2)               ------>NtERF2
 <---------GATA12                                     <---------ARR14(2)              --------->ANAC58
 --------->RVE1(2)                              <----------CDC5                       --------->DEAR3(1)
 --------->ARR14(2)  <---------HSFB2a(2)    ------>NtERF2           <----------DOF2   <---------ATERF1(2)
 <---------ARR14(2)  --------->HSFB2a(2)    <---------ZAT18         --------->TOE2(3) --------->RAP2.6(2)
 --------->ARR11(2)  ------>ZmHOX2a(1)   <------MYB83 <---------ARR11(2)              --------->ANAC46
 <---------ARR11(2) <---------LBD16      <------MYB46(1)          --------->At4g35610 --------->ANAC58
------->MYB46(3)   <---------ANAC46 <---------TOE2(3) --------->ARR11(2)              --------->ATERF1(2)
------->RAV1(1)  --------->ZAT18    <---------YAB1   <------ZmHOX2a(1)    --------->ARR11(3)   -----
-NtERF2 --------->ZAT14         --------->YAB1 ----------->RAV1(2)--------->ICU4     <---------RAP2.6(2)
 
aacaaatccactgcaattagtgtcctggaagacaatattaagcttggtgcccctgaggatactctggtcagcattaatgtcttcaatggccgccacaaac  13758800
        <---------At4g35610                                <---------ANAC58
       --------->RAP2.6(2)                                 <---------ANAC58
      <---------RAP2.6(2)                                 <---------ZAT2
---->ANAC58                                       --------->DOF5.7(2)
---->ANAC46                --------->YAB5        --------->TOE2(3)                    <---------ANAC46
>MYB46(3)                  --------->YAB1        --------->YAB5                       <---------ANAC58
-MYB52(2)           ---------->DOF2            <---------TOE1(2)           >>>>>>>>>TBF1        <---
>RAV1(1)<------NtERF2     <---------YAB5 --------->GLK1(1)--------->ZAT2>>>>>>>>>TBF1 <---------ANAC58
---->ANAC58       <---------ATHB12       --------->At4g35610      <------NtERF2     --------->GLK1(2)
 
gcaagtttggccgctcttccaatgaaagaatcataagtaaacagagctccaacgtttacagagcttggcagagaagaagaagaagagtttcttgagaaac  13758900
                                                                                   --------->ANAC58
                                                                                   ----------->GT1
                                                                                   <---------ANAC55(2)
                                                                                   --------->ANAC58
                                                                              --------->YAB5
                                                                              <---------ICU4
                                                                              --------->YAB1
                                                                             <---------ATHB12
                                                                             --------->ICU4
                                                                             <---------YAB5
                                                                       --------->RVE1(2)
                                                                     <---------ARR11(3)
                                                        <---------GATA12   --------->YAB1        <--
        <---------ALFIN1                    --------->TOE1(2)      --------->HSFC1(2)           <---
      --------->ANAC46                    <-------TEIL --------->KAN1--------->ARR11(3)  --------->RVE1(2)
   -------->P                  ---------->DOF2       <---------KAN1<---------YAB5  --------->ANAC46*TSS
-------DOF2         <---------------------WRI1  <------ZmHOX2a(1)  <---------HSFC1(2)   --------->KAN1
 
tttctctaccagcaccttgtattggcaaaacccacaaagcagaaatacataggagcataaatcccatggaaacatctctaatcatcacgaaaaatcccat  13759000
                                                                                --------->ANAC58
                                                                                --------->ANAC58
                       --------->ANAC55(2)                         <---------GATA12
                       <---------ANAC58                            --------->RVE1(2)
                     <-----------GT1             --------->ARR11(1)--------->GLK1(2)
                  <---------ICU4                --------->ATHB12   <---------ARR11(3)
                 --------->ICU4                 --------->YAB5    --------->RVE1(1)
              <---------YAB5                    --------->KAN1   <---------AHL12(1)
          --------->DOF5.7(1)                  <---------YAB5    <---------AHL25(3)              <--
         --------->DOF5.7(1)             ------>MYB46(1)         --------->AHL12(1)      ------->GAMYB
        --------->DOF5.7(1)     --------->AHL20(2)              <---------AHL20(3)      --------->MYB46(3)
        --------->DAG2 <---------ANAC58  ------>MYB83           <---------AHL25(1)    <---------DOF5.7(2)
       ---------->DOF2<---------LBD16   <---------ALFIN1        --------->AHL25(1)    --------->MYB52(1)
--------DOF2----------->GT1  --------->YAB5    <---------YAB1   --------->AHL20(3)  --------->DOF5.7(2)
------DOF5.7(1) <---------RVE1(2)   <-----------GT1        ----------->GT1------>ZmHOX2a(2)  <------
 
cttttaatcgaaaaggagtgatttttacgggctcattatatacccacttgatgattcggagttagaaaaaaatctgatcgaacaggcattaacgaccatt  13759100
                                                                                            <-------
                                                                                            --------
                                                                                           <--------
                                                                                          --------->GATA12
                                                      <---------WOX13(2)                  --------->ARR11(3)
                                          --------->DOF5.7(1)                   ---------->DOF2
           --------->TOE2(3)              <----------ID1                     --------->RVE1(2)  <---
     --------->TOE2(3)                  --------->DOF5.7(1)             --------->TOE1(3) <---------ARR11(3)
  <-----------GT1       --------->DOF5.7(1)           --------->WOX13(2)--------->TOE2(3) <---------GLK1(2)
-------RVE1(2)        ---------->DOF2   ---------->DOF2                 <---------MYB59   <---------RVE1(2)
------CBF  --------->RVE1(2)  <-----------HVH21    <----------DOF2    ------->TEIL      ----------->ARR10
 
gattttaacatcaacatcaactagaaaaagatgggtcagacaaaaaagacaaaactttattgacattgtatcgaacctaaaatcaaagacttagattttt  13759200
                                    <---------------AtSPL3                                 ---------
                                  --------->GLK1(2)                                     <---------WOX13(2)
                                 <---------RVE1(2)                                      --------->WOX13(2)
                                 <---------GLK1(2)                                      --------->AHL12(2)
                                 <---------ARR14(2)                                     <---------AHL12(2)
                          --------->ARR11(3)                                           <---------AHL12(2)
                        --------->AHL12(1)                                            --------->AHL12(1)
                        <---------AHL12(1)                                            --------->AHL20(3)
                        <---------AHL25(3)                                            --------->AHL25(1)
                        <---------AHL20(2)                                            <---------AHL20(3)
                       <---------AHL12(2)                                             <---------AHL25(1)
                       --------->AHL12(2)                                             --------->AHL25(2)
                      --------->AHL12(2)                                              <---------AHL25(3)
                    --------->AHL25(1)                                                --------->AHL25(3)
                    --------->AHL25(3)                                                <---------AHL25(2)
                    --------->AHL20(2)                                                <---------AHL12(1)
                    <---------AHL12(3)                                                --------->AHL20(1)
                    --------->AHL12(3)          --------->ANAC58                      <---------AHL20(2)
       ------->TEIL <---------AHL20(2)          --------->ANAC58                      <---------AHL20(1)
--AHL12(1)          <---------AHL25(1)       <---------ATHB12                         --------->AHL20(2)
->AHL12(1)          <---------AHL12(1)       <------ZmHOX2a(2)                       --------->AHL25(3)
-RVE1(1)            --------->AHL12(1)  ------->TEIL                        --------->ICU4 <--------
--------GT1        --------->AHL12(2) <---------ZAT14             --------->RVE1(2)  <---------ATHB12
 
tacatatatgtatgtgtttgtatataatttatcttggattctgtaccgatcaagaaacagaactgaaactatctcagagatgatggcaataaattaacag  13759300
                                  ----------->TCP11(1)
                              <---------ANAC58
                 <---------AHL20(1)
                 --------->AHL20(1)
                 --------->AHL25(2)
                 --------->AHL25(3)
                 <---------AHL25(1)
                 --------->AHL20(2)
                 --------->AHL25(1)
                 <---------AHL20(3)
                 --------->AHL20(3)                                                    --------->DAG2
   <---------AHL20(2)         <---------ANAC58                 ---------->DOF2   ---------->DOF2   <
>MYB52(1)        <---------AHL20(2)<---------PCF2              --------->DOF5.7(1)    ---------->DOF2
---GT1          <---------ATHB12--------->ALFIN1 --------->WOX13(2)         ----------->GT1<-------TEIL
 
aactatataaaaaaaaccaataaaatagcaaatgggtgggccagacaaaacaaattagcatacgataaaagcaccaagttggataaaagaaaagttcatg  13759400
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                           ---------
                                                                                           ---------
                                                                                           ---------
                                                                                  <---------DAG2
                          --------->YAB1                                    <------ZmHOX2a(2)
                          --------->ATHB12                                  --------->CCA1(2)
                          -------->HAHB4                                    ========================
                          --------->YAB5                                   <---------GATA12---------
                          <---------ICU4                                   <---------ARR11(2)
                         --------->ICU4                                    --------->ARR11(2)
                         <---------YAB5                                    --------->GATA12<--------
                         <---------YAB1    --------->YAB5                  --------->AGP1  <--------
                       <---------ICU4      <---------------AtSPL8          --------->ARR14(2)
                       --------->YAB5     <---------YAB1                   --------->RVE1(2)<-------
                       --------->YAB1   <---------ICU4           <-------TEIL     --------->TOE2(3)
                      <---------ATHB12  --------->YAB1     ------->TEIL    <---------ARR14(2)
                      --------->ICU4   <---------ATHB51    <-------TEIL    --------->ARR11(3)
                      <---------ATHB51 --------->ICU4  <---------------AtSPL8     <---------DOF5.7(1)
               <-------MYC2          --------->YAB5    <---------------AtSPL3   ------>MYB46(1)
               ------->MYC2       ------>MYB83         --------------->AtSPL8   ------>MYB83--------
               ------->MYC3       ------>MYB46(1)      --------------->AtSPL3   -------->P <--------
               <-------MYC3     <---------MYB46(2)<---------WOX13(2)       <---------ARR11(3)
-------TEIL   <---------KAN1    <---------MYB59   --------->WOX13(2)   ---------->DOF2     ---------
 
agttcatacttcatagaacgtggcaataatgattaccaaacaattatgagtacaattagacgtacatatacatacaaagatccaacctttttaaaatttt  13759500
<- Previous    Next ->

AGI:  At2g32390.1   
Description:  ATGLR3.5 (GLUTAMATE RECEPTOR 6). Identical to Glutamate receptor 3.5 precursor (GLR3.5) [Arabidopsis Thaliana] (GB:Q9SW97;GB:Q9ZV67); similar to ATGLR3.4 (Arabidopsis thaliana glutamate receptor 3.4) [Arabidopsis thaliana] (TAIR:AT1G05200.2); similar to ATGLR3.3 (Arabidopsis thaliana glutamate receptor 3.3) [Arabidopsis thaliana] (TAIR:AT1G42540.1); similar to ATGLR3.4 (Arabidopsis thaliana glutamate receptor 3.4) [Arabidopsis thaliana] (TAIR:AT1G05200.1); similar to hypothetical protein OsJ_021514 [Oryza sativa (japonica cultivar-group)] (GB:EAZ38031.1); similar to hypothetical protein OsI_023330 [Oryza sativa (indica cultivar-group)] (GB:E
Range:  from: 13755545    to: 13759000    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version